Produced by the International Association for the Plant Protection Sciences (IAPPS). To join IAPPS and receive the Crop Protection journal online go to: www.plantprotection.org
The Egyptian cotton leafworm (Spadoptera littoralis) – a moth species found throughout the Mediterranean Basin, as well as in Africa and the Middle East – is currently a widespread pest in France. Since moth larvae are highly polyphagous, feeding upon a variety of different species, they cause damage to a diversity of crops, including corn, cotton, peppers, legumes, and tomatoes.
As part of increased efforts to reduce pesticide levels, scientists currently struggle to develop effective biocontrol methods to fight crop pests, such as strategies to disrupt their reproduction or trap them through the use of sex pheromones. However, since pheromone synthesis is expensive, other control strategies may be needed. A team of scientists led by the Sorbonne University in Paris has recently investigated the evolution of olfactory receptors in the Egyptian cotton leaf worms. The research, published in the journal Proceedings of the National Academy of Sciences, represents an important step forward toward the development of such strategies
New strategy identified to curb a fungal infection affecting more than 150 crops
Phys.Org
by University of Córdoba Tomatoes, bananas, cabbages, melons, pumpkins and cucumbers… are just some of the 150 crops of commercial interest that are victims of Fusarium oxysporum, one of the most important pathogens in the world due to the millions of dollars in losses it is responsible for and its ability to attack different types of plants. Although it can go unnoticed in the soil for more than 30 years, when it detects the roots of a host plant, it grows towards them, colonizing its vascular system and causing crops to wilt.
The application of fungicides, rotation, and the development of resistant varieties are some of the agricultural practices that have proven to be insufficient to control it, due to its high adaptability. Now, the Fungal Pathogenesis Molecular Genetics research group at the University of Cordoba has managed to attenuate the virulence of the pathogen by developing a new strategy: genetically altering a cellular pathway, making it ‘believe’ that it has the necessary resources without the need to infect crops.
The key: ‘Confusing’ the fungus
What would happen if an individual in need of food received a series of chemical signals indicating to him that, on the contrary, he was satiated and had sufficient resources? This is, despite the obvious differences, the approach upon which the scientific work was based.
Entomology Today posted: ” By Malia Naumchik With spring in full bloom, you might notice more bees buzzing outside and more pollen making you sneeze. Pollen makes big news as an aggravator of seasonal allergies, but, for bees and plants, pollen is essential for ensuring ” Entomology Today
Entomology Today May 30 The more pollen a bumble bee carries, the higher its body temperature rises, a new study confirms. As average temperatures rise amid climate change, bees and their pollination services in natural ecosystems could be threatened. Read more of this post
Left: Gloomy scales (Melanaspis tenebricosa) can be dense on urban red maple trees. One scale in the center of the image has its outer cover removed. Right: Scales attract predators such as this minute lady beetle (Microweisea sp.) by directly acting as prey or by attracting other prey species that feed on scale honeydew. (Photos by Matt Bertone, Ph.D., NC State University)
By Caleb Wilson, Ph.D.
Caleb Wilson, Ph.D.
Last year, I shared findings from my research on infestations of scale insects in urban trees. Because scales are eaten by many arthropod predators and used as hosts by many parasitoid wasp species (collectively referred to as “natural enemies”), we studied the natural enemy communities found within urban trees infested with scales relative to uninfested trees. In short, our findings, published in October 2022 in Environmental Entomology, suggest that tolerating scales on urban trees can conserve natural enemies both within trees and in shrubs below them. By supporting large natural enemy communities in plants below them, scale-infested trees may also prevent pest outbreaks on plants growing near them.
Since completing that original study, my advisor Steven Frank, Ph.D., at North Carolina State University and I conducted two follow-up studies within this system to better understand 1) what kinds of predators are supported by scale-infested trees and 2) do scale-infested trees support natural prey removal (also known as “biological control”) in shrubs growing below them?
To answer the first question, we examined the community of spiders that we found in scale-infested and uninfested tree canopies and in holly shrubs below these trees. Spiders were the most abundant natural enemy group we collected in trees and shrubs, and spiders are an ecologically diverse group of predators that use a variety of strategies to capture and kill their prey. Because spiders are important predators of many landscape pests, identifying environmental factors that conserve spiders, such as pest densities in trees, will inform sustainable pest management practices in urban landscapes.
Spiders are often separated into different “guilds” based on their different prey-capture strategies. For example, orb-web weaving spiders create distinct orb-shaped webs that are often oriented vertically to capture prey. In comparison, sheet-web weaving spiders create small, flat webs that are oriented horizontally, while active hunting spiders do not create webs at all but rather chase and capture their prey.
Left: Sheet-web weaving spiders create small horizontal webs that the spider typically hangs below. In certain shrubs such as yaupon holly (Ilex vomitoria), these webs can be abundant at certain times of the year. (Photo by Caleb Wilson, Ph.D.) Right: Hunting siders such as this green lynx spider (Peucetia sp.) chase and capture their prey. (Photo by Matt Bertone, Ph.D., NC State University)
Knowing which spider guilds are abundant in scale-infested trees will indicate which spiders benefit from the recruiting of natural enemies associated with scale insects. This is important because researchers have documented that certain spider families or guilds are often rarer in cities compared to rural areas. If scale-infested urban trees support these otherwise uncommon spider guilds, scale-infested trees may be important for conserving spiders that would otherwise be sensitive to urban development.
So, what did we find? We found that scale-infested trees hosted more orb-web weaving spiders relative to uninfested trees, while holly shrubs under infested trees hosted significantly more orb-web weavers, space-web weavers, and active hunting spiders relative to shrubs under scale-uninfested trees.
Top left: A common orb-web weaving spider species is the yellow garden spider (Agriope aurantia). (Photo by Caleb Wilson, Ph.D.) Top right: Space-web weaving spiders such as the common house spider (Parasteatoda tepidariorum) create irregular cobwebs. (Photo by Matt Bertone, Ph.D., NC State University) Bottom: Active hunting spiders such as this Wulfila sp. spider do not create webs; ghost spiders (family Anyphaneidae) are common representatives of this guild. (Photo by Matt Bertone, Ph.D., NC State University)
Our results suggest that tolerating scales on urban trees can help conserve orb-web weaving, space-web weaving, and hunting spiders over other guilds. More broadly, our results indicate that scales, and likely other tree pests as well, have understudied potential for spider conservation in cities.
Our second follow-up study assessed if insect prey were more likely to be removed from holly shrubs underneath scale-infested trees relative to shrubs under uninfested trees. The prey we used for these experiments were crapemyrtle aphids (Tinocallis kahawaluokalani), dead Drosophila adults (a mixture of D. suzukii and D. melanogaster), and caterpillars (Helicoverpa zea and Spodoptera frugiperda). On large, planted holly shrubs underneath infested and uninfested trees we recorded removal of all three prey types. These shrubs comprised two different species: Ilex vomitoria, a native species, and I. cornuta, an exotic holly species.
Left: A crape myrtle leaf is infested with crapemyrtle aphids (Tinocallis kahawaluokalani). Middle: A sac spider (family Clubionidae) feeds on a corn earworm caterpillar (Helicoverpa zea) on a Chinese holly (Ilex cornuta). Right: A notecard with 10 Drosophila spp. adults is attached to a yaupon holly (Ilex vomitoria) shrub. (Photos by Caleb Wilson, Ph.D.)
We ran similar experiments that measured the removal of Drosophila and caterpillar prey on potted holly shrubs underneath both tree types. We ran prey-removal experiments on planted and potted hollies so that we could compare our results in shrubs that ground-dwelling predators were able to access (planted hollies) and in potted hollies that ground-dwelling predators could not access. To keep ground-dwelling predators out of potted hollies, we coated the outside of pots with Fluon and we treated the soil in these pots with permethrin.
Left: A lady beetle larva (Harmonia axyridis) feeds on Drosophila spp. adults. Right: A lacewing larva (family Chrysopidae) feeds on Drosophila spp. adults. For experiments, we placed Drosophila spp. adults on notecards and recorded their removal after one day. We added sand to these cards to provide traction to predators. (Photos by Caleb Wilson, Ph.D.)
Yaupon hollies (Ilex vomitoria) growing below scale-infested willow oaks (Quercus phellos) receive associational pest resistance due to the movement of natural enemies from tree canopies to shrubs below them. (Photo by Caleb Wilson, Ph.D.)
In this case, we found that Drosophila adults in planted hollies and caterpillars in potted hollies were more likely to be removed underneath infested trees relative to uninfested trees. In all other experiments we found no effect of tree type on prey removal. We also found that caterpillars were more likely to be removed from native Ilex vomitoria shrubs relative to exotic I. corntua shrubs.
In addition to supporting natural enemies in plants below them, scale-infested trees can also support natural pest regulation in shrubs below them. However, this effect can be influenced by the type of insect prey present within shrubs, as well as what species of shrub is present.
What should we take away from these studies? First, scale-infested trees have the potential to conserve natural enemies both within their canopies and in shrubs below them. Second, scales and the diverse arthropod communities found in close association with them, conserve orb-web weaving, space-web weaving, and active hunting spiders. Third, by conserving natural enemies, scale-infested trees also support biological control of pests in plants below them.
Scale insects appear to have understudied conservation potential for natural enemies in urban landscapes, and these conservation benefits also have the potential to prevent pest issues in nearby plants. Although scales are often considered pests in urban trees, our work indicates that scales are important for conserving natural enemies and their biological control services.
Caleb Wilson, Ph.D., is a postdoctoral research associate in the Department of Entomology at Michigan State University and a recent doctoral graduate from North Carolina State University. Email: wils1852@msu.edu.
Diverse landscapes help insects cope with heat stress, study shows
by Kati Kietzmann, German Centre for Integrative Biodiversity Research (iDiv)Halle-Jena-Leipzig The movements of this beetle (Carabus coriaceus) have been tracked with the help of a RFID tag. Credit: Stefan Bernhardt, iDiv
Global warming is affecting terrestrial insects in multiple ways. In response to increasingly frequent heat extremes, they have to either reduce their activity or seek shelter in more suitable microhabitats. A new study led by researchers from the German Center for Integrative Biodiversity Research (iDiv) and Friedrich Schiller University Jena shows: The more diverse these microhabitats are, the better for the insects. For their study, published in Global Change Biology, they developed a new approach to accurately track insect movements and activity.
Anthropogenic global warming has far-reaching implications for the world we live in. Some of these changes might be less obvious and often go unnoticed for a long time. For example, a warming climate is also affecting terrestrial insects such as beetles, ants, and butterflies. To survive under great heat, they have to either reduce their physical activity to conserve energy, or seek shelter in a cooler environment.
A natural and diverse ecosystem offers many microhabitats that provide more favorable climate conditions as well as food for insects. But in the face of land-use changes, the diversity of these microhabitats is declining. This is not only affecting terrestrial insects, but also the important ecosystem services they are providing, such as pollination, the formation of humus and general improvement of soil quality.
A team led by researchers from iDiv and Friedrich Schiller University Jena studied the effects of a warming climate and the availability of microhabitats on the activity of terrestrial insects. For their study, they used the iDiv Ecotron, which consists of several isolated ecosystems (so-called EcoUnits). Here, environmental conditions such as light, nutrients and humidity can be controlled and manipulated. The researchers studied six insect species that can be found in the surrounding area of Leipzig (Germany), including the beetle species Carabus coriaceus, firebugs (Pyrrhocoris apterus), and house crickets (Acheta domesticus).
Accurate activity tracking based on radio frequency identification
To accurately track the movements of a total of 465 insect individuals, the researchers developed a new tracking method based on radio frequency identification (RFID). “Heavy GPS collars that are typically used for large mammals are not suitable for small animals such as insects. With the help of a very light RFID tag, we can now also track movement patterns of insects in complex habitats,” says first author Jördis Terlau, who led the study as a doctoral researcher at iDiv and Friedrich Schiller University Jena.
Within the EcoUnits, the researchers simulated heat extremes based on data that had been recorded by the Deutscher Wetterdienst (DWD) in 2018 and 2019. Temperatures were reaching a maximum of 38.7°C. They also added leaf litter from four different tree species to the EcoUnits—the litter was either separated or well-mixed. With the help of the RFID tracking, they found that insects apply different strategies in response to heat extremes, depending on the microhabitat conditions. In mixed litter conditions, the insects significantly reduced their activity. In contrast, they increased their activity when the leaf litter was spatially separated. “We assume that mixed leaf litter not only provides protection from heat, but also various food sources. Insects can move less and still find enough food, which helps them save energy,” says Jördis Terlau.
Diverse microhabitats can mitigate the effects of heat extremes
However, in environments with spatially separated leaf litter, the insects had to move more in order to find enough food and leave their shelter. This, in turn, increased their energy consumption, which is of disadvantage under extreme heat and increases the risk of overheating. “This stresses the importance of diverse habitats and microhabitats. In this way, the effects of extreme heat on insects can be significantly mitigated,” says last author Dr. Myriam Hirt from iDiv and Friedrich Schiller University Jena.
The study also highlights the various benefits of heterogeneous habitats such as mixed forests. They provide terrestrial insects with favorable conditions and food, and help ensure that important ecosystem services can be provided in the future also in the face of climate change.
More information: Jördis F. Terlau et al, Microhabitat conditions remedy heat stress effects on insect activity, Global Change Biology (2023). DOI: 10.1111/gcb.16712
Plant disease outbreaks pose significant risks to global food security and environmental sustainability worldwide, and result in the loss of primary productivity and biodiversity that negatively impact the environmental and socio-economic conditions of affected regions. Climate change further increases outbreak risks by altering pathogen evolution and host–pathogen interactions and facilitating the emergence of new pathogenic strains. Pathogen range can shift, increasing the spread of plant diseases in new areas. In this Review, we examine how plant disease pressures are likely to change under future climate scenarios and how these changes will relate to plant productivity in natural and agricultural ecosystems. We explore current and future impacts of climate change on pathogen biogeography, disease incidence and severity, and their effects on natural ecosystems, agriculture and food production. We propose that amendment of the current conceptual framework and incorporation of eco-evolutionary theories into research could improve our mechanistic understanding and prediction of pathogen spread in future climates, to mitigate the future risk of disease outbreaks. We highlight the need for a science–policy interface that works closely with relevant intergovernmental organizations to provide effective monitoring and management of plant disease under future climate scenarios, to ensure long-term food and nutrient security and sustainability of natural ecosystems.
by University of Liverpool A study led by University of Liverpool scientists has revealed a new way to improve crop growth, meeting a significant challenge to increase crop productivity in a changing climate with a growing population.
With global levels of carbon dioxide (CO2) rising and the population set to reach almost 10 billion by 2050, Professor Luning Liu’s team of researchers used synthetic biology and plant engineering techniques to improve photosynthesis, creating a template that can be used on a mass scale.
Photosynthesis is the process by which plants use atmospheric CO2 to create nutrients, which are crucial for growth and the global ecosystem. The newly published paper details how the team of scientists have improved Rubisco, a key enzyme present in photosynthesis that converts CO2 into energy. Usually Rubisco is inefficient and limits photosynthesis in major crops. However, many microorganisms including bacteria have evolved efficient systems, named “CO2-concentrating mechanisms,” to improve Rubisco.
The entomopathogenic fungus (EPF), Beauveria bassiana, is reported as the most potent biological control agent against a wide range of insect families. This study aimed to isolate and characterize the native B. bassiana from various soil habitats in Bangladesh and to evaluate the bio-efficacy of these isolates against an important vegetable insect pest, Spodoptera litura. Seven isolates from Bangladeshi soils were characterized as B. bassiana using genomic analysis. Among the isolates, TGS2.3 showed the highest mortality rate (82%) against the 2nd instar larvae of S. litura at 7 days after treatment (DAT). This isolate was further bioassayed against different stages of S. litura and found that TGS2.3 induced 81, 57, 94, 84, 75, 65, and 57% overall mortality at egg, neonatal 1st, 2nd, 3rd, 4th, and 5th instar larvae, respectively, over 7 DAT. Interestingly, treatment with B. bassiana isolate TGS2.3 resulted in pupal and adult deformities as well as decreased adult emergence of S. litura. Taken together, our results suggest that a native isolate of B. bassiana TGS2.3 is a potential biocontrol agent against the destructive insect pest S. litura. However, further studies are needed to evaluate the bio-efficacy of this promising native isolate in planta and field conditions.
Introduction
The reduction of crop losses due to insects is becoming a bigger challenge for the world’s food production. Due to concerns about their impact on human health, the environment, and the food chain, many of the older, less expensive chemical insecticides are no longer being registered1. New technologies like expensive, more selective chemicals and genetic modification are being used, but this increased selection pressure accelerates the evolution of resistance in insect pests. Global agriculture urgently needs more environmentally friendly pest management techniques.
The tobacco caterpillar, Spodoptera litura (Fabricius) (Lepidoptera: Noctuidae), is one of the most devastating pests of 120 crop plants, including cauliflower, groundnuts, cotton, onions, tomatoes, brinjal, turnips, and cabbage2. Each year, it goes through five to six overlapping generations, and if it is not promptly treated, it might cause significant crop losses up to complete destruction3. Insecticides are the most often used method for controlling this problem. Although this is effective in reducing pest populations in the short term, long-term exposure to insecticides may cause S. litura to develop the 3 R’s issues, viz., resistance, resurgence of insects, and residues on crops, like other Noctuidae members4. In addition, the use of pesticides leads to ecological imbalances by destroying non-target organisms and their natural enemies, parasites, and predators. The public’s growing concern over the potential ecological and health risks of synthetic pesticides has shifted the focus of research toward more environmentally benign methods for controlling insect pests5.
Insect-pathogenic or entomopathogenic fungi (EFP) (Fungi: Ascomycota, Order: Hypocreales) cause disease in insects. These entomopathogens are used as biocontrol agents, or “biopesticides,” for the management of insect pests6. They provide an alternative to chemical insecticides for protecting crops7 and reducing the harmful environmental impacts of chemical insecticides8. An increasing number of products based on EPF are being registered as insecticides and used in developed and developing countries like the United States of America, the United Kingdom, Australia, Canada, China, India, etc.8.
Among the members of the genus Hypocreales, Lecanicillium sp., Beauveria sp., and Metarhizium sp. have been effectively used to control aphids, lepidopteron larvae, and other pests9. Among them, Beauveria bassiana (Balsamo) Vuillemin is responsible for causing white muscardine disease in a variety of insects. Beauveria infects the insect by degrading the host cuticle using mechanical and chemical forces, which are particularly advantageous in pest control because direct ingestion of fungal propagules is not needed by insects, thus also becoming active against the non-feeding stages of insects10. In addition, among the cyclic hexadepsipeptide mycotoxins produced by the different EPF, beauvericin, produced by B. bassiana, has shown the most effective larvicidal properties11.
Like other Hypocreales, the species of Beauveria show pleomorphic life stages. They are often described as cryptic fungi, i.e., morphological characteristics are changed in response to the environment, and thus morphological description fails to clarify their systematics at species level12. Nowadays, researchers are using polymerase chain reaction (PCR) based molecular techniques to reconstruct the Beauveria phylogeny for accurate identification of Beauveria species. Among the molecular markers, the internal transcribed spacer (ITS) region of rDNA is considered a universal bar code for fungus identification13. But in case of Hypocreales, ITS analysis produced low resolution in many cases and failed to resolve the phylogeny of Beauveria14. Additional genomic markers like translation elongation factor-1α (TEF) are needed for the species-level determination of Beauveria to be made correctly14.
Although B. bassiana showed a broad spectrum of pathogenicity against a wide range of insects, its bio-efficacy depends on the isolation source and life stages of the target stages. Insecticide resistance and resurgence issues can be effectively addressed by controlling insect pests with local isolates of fungus15. These native isolates also have higher survival and persistence abilities under local environmental conditions16. In conservation agriculture guidelines, it is also important to isolate potential native bioagents to prevent contamination from imported biopesticides. In addition, the pathogenicity of the biocontrol agent differs according to the different life stages of the target insect17. Identification of the more suspectable stage of insects against fungal inoculum increases the bio-efficacy of biological control strategies in field conditions. Therefore, the present investigation was carried out to isolate and molecularly characterize native Beauveria isolates and test their bio-efficacy against different life stages of S. litura.
Results
Isolates of Beauveria
Among the isolated fungal isolates on selective medium, seven isolates showed characteristics of the morphology of Beuaveria species. The single fungal colonies of the isolates were white in color, round, lightly elevated with a powdery appearance, and lightly downy with circular rings. Conidia were hyaline and round. Single cell conidiophores were short, densely clustered, and hyaline (Fig. 1).
Figure 1
Molecular identification and phylogeny of Beauveria isolates
The partial sequence datasets of ITS and TEF were processed and analyzed individually through Geneious V.11 software, and accession numbers were obtained from NCBI (Table 1). The genomic ITS and TEF data of seven isolated Beauveria isolates showed BLAST similarity, with many references to B. bassiana in BLAST search results in the NCBI database. The reconstructed maximum likelihood phylogenetic tree of the ITS data set showed that the seven morphologically characteristic isolates were clustered with the reference B. bassiana isolate with a moderate bootstrap support value (60%) (Fig. 2). Furthermore, a tree constructed with the TEF data set showed the maximum support (100%) for the clade containing isolated Beauveria isolates and references to B. bassiana (Fig. 3). Thus, both the ITS and TEF data sets confirmed the isolated strains as B. bassiana.Table 1 NCBI accession numbers of isolated B. bassiana isolates.
Overall mean mycelial growth revealed that the fungal isolate TGS2.3 (388.27 ± 10.29 mg/100 mL) exhibited the highest biomass production, and the lowest growth was observed in TGS1.2 (208.8 ± 8.03 mg/100 mL) (Fig. 4).
Figure 4
Insect bioassay
Seven days following infection of the 2nd larval instar by seven B. bassiana isolates revealed that TGS2.3 had the highest mortality rates (81.72 ± 2.15%) followed by TGS2.1 (72.40 ± 3.46%), BeauD1 (61.29 ± 1.08%), BeauA1 (51.61 ± 2.15%), KSS1.1 (49.46 ± 4.69%), TGS1.2 (46.59 ± 2.71%), and KSS2.2 (43.73 ± 3.78%) (Fig. 5).
Figure 5
The findings implied that the death of 2nd instar larvae of S. litura treated with TGS2.3 and TGS2.1 occurred mostly during the first two days of infection, especially on the first day for TGS2.3. The mortality was caused more gradually from day-one to day-seven by the other Beauveria isolates, viz. BeauA1, BeauD1, KSS1.1, KSS1.2, KSS2.2, and TGS1.2 (Fig. 6).
Figure 6
As the first day was when the most deaths occurred, results were statistically analyzed to ascertain which isolates induced the highest day-one mortality (causing high mortality within 24 h of infection). Samples infected with TGS2.3 (56.67 ± 7.02%) had the highest day-one mortality, followed by TGS2.1 (43.33 ± 3.51%) (Fig. 7).
Figure 7
Hatchability and neonate larval mortality after TGS2.3 treatment
Egg hatchability was drastically reduced in the TGS2.3-treated eggs compared to the control. The isolate TGS2.3 induced 81.25 ± 2.75% egg mortality, whereas in control it was 18.5 ± 2.65% (Fig. 8). The 7-days post treatment data also revealed that TGS2.3 induced 57.25 ± 6.34% neonatal larval mortality, whereas in control it was 8.25 ± 2.63% (Fig. 9).
Figure 8Figure 9
Bioassay against different larval stages of S. litura by B. bassiana isolate TGS2.3
The larvae treated with the TGS2.3 isolate succumbed to fungal infection and showed different mortality rates in various larval stages. The highest mortality was recorded in 1st instar larvae (94.45 ± 4.60%) and the lowest was in 5th instar larvae (56.56 ± 2.07%). The mortality rates in 3rd and 4th instar larvae were statistically similar (Fig. 10).
Figure 10
Cumulative mortality over 7 days demonstrates that 1st instar larvae had the highest day-one mortality, which progressively rose until the 4th day. The death of 2nd instar larvae began on day-one and subsequently increased until day-five. The 3rd instar larvae did not die until the 3rd day, and the death rate progressed until the 6th day. The death of larvae in the 4th and 5th instars occurred on the 4th day and subsequently increased until the 7th day (Fig. 11). Overall, the mortality across various time points revealed all larval instars of S. litura to be susceptible to the fungus TGS2.3.
Figure 11
Mycosis and sub-lethal effects
The mobility of the infected larvae was reduced. The larvae were stiff and rigid after dying. Within two days of death, the deceased larvae began to produce mycelium. (Fig. 12). The B. bassiana infection was verified by the slides prepared from this fungus’ growth. When compared to control larvae, B. bassiana negatively impacted the emergence of adults from the 2nd, 3rd, 4th, and 5th instars. A smaller number of adults (7.11–37.94%) emerged from fungus treated larvae than from control larvae (94%) (Fig. 13).
Figure 12Figure 13
Deformities
The fungal infection caused a wide range of abnormalities. When some of the treated larvae molted into pupae, they did not entirely detach from the exuvium (Fig. 14). Some pupae lacked a completely developed cuticle. When 2nd instar larvae were treated with B. bassiana, they had 9.33 ± 2.08 percent pupal deformities. Similarly, the pupal deformity was 7.67 ± 1.53, 10 ± 2 and 6.67 ± 1.53 percent owing to the treatment of 3rd, 4th, and 5th instar larvae, respectively (Fig. 15). Adults developed from fungus infected larvae had 3.67–10% deformities (Fig. 16) with folded, undeveloped wings (Fig. 17). The control group, however, showed no deformation.
Figure 14Figure 15Figure 16Figure 17
Discussion
The tobacco caterpillar (S. litura) is one of the most devastating pests of various crops. Insecticides are the most commonly used method for controlling this problem. The use of pesticides leads to ecological imbalances by destroying non-target organisms and their natural enemies, parasites, and predators. The public’s growing concern over the potential ecological and health risks of synthetic pesticides has shifted the focus of research toward more environmentally benign methods. Among them, B. bassiana causes white muscardine disease in a wide range of insects. Insecticide resistance and resurgence issues can be effectively addressed by controlling insect pests with local isolates of fungus and targeting more suspectable stages of insects.
In this study, seven B. bassiana isolates were isolated from soil samples and reported for the first time in Bangladesh as local isolates. The morphology described by previous studies5,18.was similar to that of our seven isolates. The ITS phylogeny produced a moderate support value for these seven isolates, which confirmed the inadequacy of the ITS analysis that had been previously reported1,14,19. However, ITS could be used for quick screening of a wide range of field isolates because of its PCR amplification efficiency20,21,22 and the availability of reference data23. Further molecular analysis with TEF data supported the phylogenetic position of seven isolates in the B. bassiana clade very strongly and proved its efficiency in resolving phylogenies for Hypocreales fungi1,14,19.
To find the best insect pathogenic B. bassiana isolate, the overall and daily mortality of 2nd instar larvae was investigated to determine the mortality induced by each fungal isolate. The highest mortality rate was induced by B. bassiana isolate TGS2.3 and could be because of higher insect pathogenic properties like conidial adhesion, germination rate, growth condition, or the production of enzymes or secondary metabolites. The very first stage of fungal infection is conidial attachment, and the strength of conidial attachment is a crucial indicator of the virulence of an entomopathogenic fungus. Fungal cell attachment to the cuticle may involve specific receptor-ligand and/or nonspecific hydrophobic and electrostatic mechanisms24,25,26. If the adhesion strength of EPF is weakened, then it could result in the washing off of the conidia from the host, thus preventing the infection27. The fluctuation of virulence among different isolates of B. bassiana may be due to their different levels of hydrophobic nature or their biochemistry.
Secondary metabolite synthesis might let EPF get past the immunological defenses of the insects and hasten mycosis6. According to some research, EPF B. bassiana creates host-specific secondary metabolites that, at low quantities, may result in 50% mortality11,28. The strain TGS2.3, which showed the highest insect mortality rate, may produce biologically active compounds with insecticidal activity against S. liturta. Further investigation is required to determine the bioactive compounds produced by B. bassiana isolate TGS2.3. The investigation and production of these compounds may open up new arrays of possibilities for controlling invasive crop pests.
The parameters, such as conidial germination and the production of hydrolytic enzymes are associated with the virulence of EPF21,29,30,31. A faster germination rate was found to exhibit higher virulence in B. bassiana29. The day-one mortality of TGS2.3 was the highest among all the isolates, which suggested that TGS2.3 has a higher germination rate. Hydrolytic enzymes such as protease, chitinase, and lipase are secreted by EPF to degrade the cuticle of host species to infect them32. Higher enzyme activity may be one of the reasons for the higher virulence of TGS2.3. Further investigation is needed to verify these hypotheses for our high-performing Beauveria candidate, TGS2.3.
The immobility of eggs is the main reason for insect vulnerability to microbial infections33. The nutrient requirement of an egg to develop into a hatchling is excessive, and they are highly targeted by pathogenic microbes at this stage34. This study showed that the eggs of S. litura were highly susceptible to TGS2.3. Similar results were found in previous studies where B. bassiana induced egg mortality in S. frugiperda35,36 and Phthorimaea operculella37. The isolate TGS2.3 also induced mortality in neonate larvae, which is similar to another study conducted by Idrees et al.17.
The mortality of larvae was highest in the 1st instar, and it gradually decreased with the advancement of each stage. The 1st instar larvae experienced 38% higher mortality than the 5th instar larvae. This indicates the decreased susceptibility of larvae with age. Shweta and Simon38 used B. bassiana against S. litura Fab. (Tobacco Caterpillar) in which the 1st and 2nd instar larvae showed higher mortality than the later stages. These variations in mortality between various instars might be attributed to enzymatic activity. According to different studies, detoxification enzyme activity changes significantly across and within developmental stages. The activity is modest in the egg stage, rises with each larval or nymphal instar, and ultimately decreases to zero during pupation39,40.
The EPF isolate TGS2.3 demonstrated sub-lethality over the life stages of S. litura. Pupal and adult deformities were produced as a consequence of the fungal infection in the larval stage. The larvae were unable to adequately transition into pupae. Insect molting has reportedly been hampered by B. bassiana41. Since the development of new cuticles during the molting process heavily depends on nutrients, any stage in the process might be affected if there is a nutritional imbalance in the hemolymph caused by a fungal infection. This sub-lethality of B. bassiana isolate TGS2.3 suggests a relatively prolonged sub-lethal influence of the fungi on S.litura, which may reduce S.litura populations more effectively in addition to direct mortality.
In summary, this study found that, the most potent isolate, TGS2.3, was effective against egg hatching and all stages of S. litura caterpillars and suggested that this fungal isolate could be utilized to target both the hatching and feeding stages of this target insect. Alongside, early stages of larval development of S. litura were more susceptible to fungal infection. The sub-lethal effects also demonstrated that once exposed to an entomopathogen, B. bassiana isolate TGS2.3 has the capability to kill insects at any descendant life stage of insect and reduce adult emergence. This study warrants further in planta evaluation in both laboratory and field conditions to evaluate the bio-efficacy of native B. bassiana isolates precisely. However, the findings of this research provided the potential for developing alternative S. litura pest control techniques as well as for limiting the use of synthetic pesticides, thereby minimizing their detrimental effects on the ecosystem.
Methods
Collection of soil samples
Soil samples were obtained from the Bhawal Sal Forest and agricultural fields in Gazipur, Bangladesh. To construct the composite sample, five different soil samples weighing a total of 250–300 g were mixed from a depth of 10–15 cm using a soil sampler. Until they were all studied, the soil samples were kept in distinct zip-lock bags with labels and maintained at 4 °C in a cold room.
Isolation of fungus
A soil suspension containing five grams of soil and 50 mL of 0.1% Tween 80 was made in a screw-cap plastic tube and incubated at room temperature for 3 h after being sieved through a 5 mm screen. Five inversions of each tube were performed at intervals of 30 min. The tubes were retained for 20 s after incubation to allow for sedimentation, and 100 µL of supernatant from each tube was plated on a Petri plate with Sabouraud dextrose agar (SDA) medium (peptone 10 g/L, agar 10 g/L, dextrose 40 g/L, and CTAB 60 mg/L). To avoid bacterial contamination, streptomycin (30 mg/L) was also added. Following inoculation, all plates underwent a two-week incubation period at 22 °C. Every 2–3 days, plates were checked for recognizable, thick, compact white mycelium development. Hypocreales-like isolates were isolated and sub-cultured.
Morphological study
Both the vegetative and reproductive structures of fungal colonies on SDA were examined using microscopy immediately after sporulation. From the outermost part of the fungal colony, little plaques were transferred to glass slides and inspected under a compound light microscope.
Sub-culture, DNA isolation, and molecular characterization
On SDA agar plates without antibiotics, the fungal isolates were sub-cultured for DNA isolation and sequencing. The procedure described by Islam1 was used to extract the DNA.
Briefly, a little lump of fungal mycelium from a 7-day-old culture was placed in an Eppendorf tube, mashed with a sterile plastic pestle, and then suspended in 1 mL of lysis buffer (400 mM Tris–HCl, pH 8.0, 60 mM EDTA, 150 mM NaCl, and 1% SDS), which was then incubated at 50 °C for 1 h in a heat block. A volume of 150 μL of precipitation buffer (5 M potassium acetate, 60.0 mL; glacial acetic acid, 11.5 mL; distilled water, 28.5 mL) was added in the tube and vortexed shortly, then incubated on ice for 5 min. The supernatant from the centrifugation was transferred to a fresh tube along with 500 mL of isopropanol to precipitate the DNA. After centrifugation at 18,000 rcf for 20 min, the DNA pellet was recovered and washed with 1 mL of 70% ethanol. After being air dried for ten minutes, the DNA pellet was dissolved in 100 µL of Tris–EDTA (TE) buffer. In a nanodrop, the DNA’s purity was examined. Polymerase chain reaction (PCR) was used to amplify the ITS region using the primers ITS1F: CTTGGTCATTTAGAGGAAGTAA and ITS4R: TCCTCCGCTTATTGATATGC in accordance with the profile: denaturation at 90 °C for 2 min, then 35 cycles of denaturation at 95 °C for 30 secs, annealing at 55 °C for 30 secs, extension at 72 °C for 1 min, and finally extension at 72 °C for 15 min1. The 5′-TEF region was amplified using EF1TF (5′-ATGGGTAAGGARGACAAGAC) and EF2TR (5′-GGAAGTACCAGTGATCATGTT) after the profile underwent an initial denaturation at 94 °C for 5 min, followed by 35 cycles at 94 °C for 40 s, 65 °C for 40 s, 72 °C for 2 min, and a final extension at 72 °C for 10 min19. The PCR product was electrophoresed in 1% agarose in 1 × TBE buffer at 120 V with GelRed nucleic acid stain and photographed with a molecular imager under UV light. For sequencing, the PCR products were sent to Macrogen, Korea.
Sequence analysis and phylogenetic tree preparation
The Sanger sequencing data of the fungal isolates were produced, and a BLAST search on the National Center for Biotechnology Information (NCBI) database was completed. The partial sequence datasets of ITS and TEF were submitted to NCBI for getting accession number. The sequences matched reference genome sequences obtained from NCBI. The Geneious V.11’s MAFT plug-in was used for multiple alignments, and the final alignment was fixed manually. Phylogenetic trees were developed by maximum likelihood analysis for the data sets using the Geneious V.11 RAxML plug-in using rapid bootstrapping and searching for the best scoring ML tree from 1000 bootstrap replicates in the GTR-GAMMA model.
Insect rearing
Eggs of S. litura were obtained from the existing culture at the Entomology Division, Bangladesh Agricultural Research Institute (BARI), Gazipur, Bangladesh. Homogenous larvae were obtained from eggs hatched on the same day. The larvae were grown in sterile plastic boxes containing pieces of okra disinfected with 0.5% (v/v) sodium hypochlorite for 10 min, maintained at 25 ± 2 °C and 65 ± 5% RH42.
Production and Collection of Beauveria conidia
Sabouraud’s Dextrose Agar (SDA) medium was used in this study. A 10 mm actively grown culture of B. bassiana was placed individually at the center of the 60 mm petri dish containing 10 mL of solid SDA media43. The inoculated plates were incubated at 28 ºC for 7 days. The conidial suspension of the isolates was then prepared by flooding the dishes with 10 mL of sterile Tween 80 (0.05%), the agar surface was gently scraped with sterile glass rods, and the suspension was collected in sterile 250 mL beakers. The suspension was then adjusted to 50 mL and mixed using a hand mixer to separate and disperse the conidia, and finally the conidial density was adjusted to 1.5 × 108 conidia per ml using a hemocytometer44. Before the bioassay experiment, conidial germination was tested on SDA agar medium.
Growth in liquid medium
A volume of 250 mL Sabouraud’s Dextrose Broth (SDB) was prepared in a 500 mL Schott bottle, and the final pH was adjusted to 6.5. The liquid broths were then inoculated with a 10 mm culture disc of the fungus. Three replications were maintained for all the B. bassiana isolates. The entire setup was kept in a shaker incubator at 25 °C temperature at 120 rpm for 10 days. White cotton ball-type growth was observed after 7 days. The mycelia were then filtered through a pre-weighed filter paper and dried in a hot air oven at 70 °C until a constant weight was obtained. This revealed the biomass production capability of all the fungal isolates 43.
Virulence of B. bassiana isolates against eggs and hatched larvae
Freshly laid egg masses that were 1–2 days old were collected and counted under a dissecting microscope. A batch of 50 eggs was separated using a hairbrush and transferred into a petri dish. A volume of 10 mL of conidial suspension (1.5 × 108 conidia/mL) was made using 0.05% Tween 80. The suspension was then sprayed over the egg masses. For control, only Tween 80 was used. Each treatment was repeated four times. 7 days after the treatment (DAT), the number of hatched and unhatched eggs was counted. The newly hatched larvae were then fed, incubated at 25 ± 2 °C, and monitored for the next 7 days. The mortality of each treatment was carefully recorded17.
Insect bioassay
Freshly laid eggs were collected and hatched to obtain homogenous larvae. The assay was conducted on 2nd instar larvae of S. litura. A set of 10 larvae in triplicate were dipped individually into a 10-mL conidial suspension of Beauveria isolates (1.5 × 108 conidia/mL) for 5 s. After treatment, transferred each set of larvae to a separate, sterile plastic box. To each box, added moist blotting paper and a piece of disinfected okra as feed. Changed the paper and feed on alternate days. At 7 DAT, the mortality of larvae was recorded according to the isolates42.
Evaluation of sublethal effects
Larvae that survived the fungal treatment were further reared until pupation at 25 ± 2 °C and 60–70% relative humidity to see the sublethal activity, such as variation in development, any kind of deformity, and longevity compared to the control. Observations were made on larval and pupal deformity, adult emergence, and any morphological deformity in various developmental stages3.
Statistical analysis
Mortality was corrected by Abbott’s formula45. The percent data were transformed by the arcsine transformation. The data were subjected to an analysis of variance (ANOVA), followed by a comparison of the means of different treatments using the least significant difference (LSD). Analyses were performed using R version 3.4.2.
Data availability
The partial sequence data of ITS and TEF genomic regions of fungal isolates during the current study are available in the NCBI repository under the Accession Numbers OP784778–OP784784 and OP785280–OP785286 (will be available on December 4 2022), respectively. The statistical datasets used and/or analyzed during the current study are available from the corresponding author upon reasonable request.
References
Islam, S. M. N. Systematics, Ecology and Plant Associations of Australian Species of the Genus Metarhizium (Queensland University of Technology, 2018).BookGoogle Scholar
Dhanapal, R., Kumar, D., Lakshmipathy, R., Rani, C. S. & Kumar, V. M. Isolation of indigenous strains of the white halo fungus as a biological control agent against 3rd instar larvae of tobacco caterpillar, Spodoptera litura (Fabricius) (Lepidoptera: Noctuidae). Egypt. J. Biol. Pest Control30, 1–5 (2020). Google Scholar
Kaur, S., Kaur, H. P., Kaur, K. & Kaur, A. Effect of different concentrations of Beauveria bassiana on development and reproductive potential of Spodoptera litura (Fabricius). J. Biopest.4, 161 (2011).CASGoogle Scholar
Mkenda, P. A. et al. Knowledge gaps among smallholder farmers hinder adoption of conservation biological control. Biocontrol Sci. Tech.30, 256–277 (2020).ArticleGoogle Scholar
Dhar, S., Jindal, V., Jariyal, M. & Gupta, V. Molecular characterization of new isolates of the entomopathogenic fungus Beauveria bassiana and their efficacy against the tobacco caterpillar, Spodoptera litura (Fabricius) (Lepidoptera: Noctuidae). Egypt. J. Biol. Pest Control29, 1–9 (2019).ArticleGoogle Scholar
Zimmermann, G. Review on safety of the entomopathogenic fungus Metarhizium anisopliae. Biocontrol Sci. Tech.17, 879–920 (2007).ArticleGoogle Scholar
Lacey, L. & Goettel, M. Current developments in microbial control of insect pests and prospects for the early 21st century. Entomophaga40, 3–27 (1995).ArticleGoogle Scholar
Kabaluk, J. T., Svircev, A. M., Goettel, M. S. & Woo, S. G. The Use and Regulation of Microbial Pesticides in Representative Jurisdictions Worldwide (International Organization for Biological Control of Noxious Animals, 2010). Google Scholar
Quesada-Moraga, E., Navas-Cortés, J. A., Maranhao, E. A., Ortiz-Urquiza, A. & Santiago-Álvarez, C. Factors affecting the occurrence and distribution of entomopathogenic fungi in natural and cultivated soils. Mycol. Res.111, 947–966 (2007).ArticlePubMedGoogle Scholar
Bateman, R., Douro-Kpindou, O., Kooyman, C., Lomer, C. & Ouambama, Z. Some observations on the dose transfer of mycoinsecticide sprays to desert locusts. Crop Prot.17, 151–158 (1998).ArticleCASGoogle Scholar
Imoulan, A., Hussain, M., Kirk, P. M., El Meziane, A. & Yao, Y.-J. Entomopathogenic fungus Beauveria: Host specificity, ecology and significance of morpho-molecular characterization in accurate taxonomic classification. J. Asia-Pac. Entomol.20, 1204–1212 (2017).ArticleGoogle Scholar
Kõljalg, U. et al. (Wiley, 2013).
Rehner, S. A. et al. Phylogeny and systematics of the anamorphic, entomopathogenic genus Beauveria. Mycologia103, 1055–1073 (2011).ArticlePubMedGoogle Scholar
Goble, T., Dames, J., Hill, M. & Moore, S. Investigation of native isolates of entomopathogenic fungi for the biological control of three citrus pests. Biocontrol Sci. Tech.21, 1193–1211 (2011).ArticleGoogle Scholar
Sain, S. K. et al. Compatibility of entomopathogenic fungi with insecticides and their efficacy for IPM of Bemisia tabaci in cotton. J. Pestic. Sci.44, 97–105 (2019).ArticleCASPubMedPubMed CentralGoogle Scholar
Idrees, A., Afzal, A., Qadir, Z. A. & Li, J. Bioassays of Beauveria bassiana isolates against the fall armyworm, Spodoptera frugiperda. J. Fungi8, 717 (2022).ArticleGoogle Scholar
Glare, T. R. & Inwood, A. J. Morphological and genetic characterisation of Beauveria spp. from New Zealand. Mycol. Res.102, 250–256 (1998).ArticleGoogle Scholar
Bischoff, J. F., Rehner, S. A. & Humber, R. A. A multilocus phylogeny of the Metarhizium anisopliae lineage. Mycologia101, 512–530 (2009).ArticleCASPubMedGoogle Scholar
White, T. J., Bruns, T., Lee, S. & Taylor, J. Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. PCR Protoc.18, 315–322 (1990). Google Scholar
Heale, J. B., Isaac, J. E. & Chandler, D. Prospects for strain improvement in entomopathogenic fungi. Pestic. Sci.26, 79–92 (1989).ArticleGoogle Scholar
Vilgalys, R. & Gonzalez, D. Organization of ribosomal DNA in the basidiomycete Thanatephorus praticola. Curr. Genet.18, 277–280 (1990).ArticleCASPubMedGoogle Scholar
Lutzoni, F. et al. Assembling the fungal tree of life: Progress, classification, and evolution of subcellular traits. Am. J. Bot.91, 1446–1480 (2004).ArticlePubMedGoogle Scholar
Boucias, D., Pendland, J. & Latge, J. Nonspecific factors involved in attachment of entomopathogenic deuteromycetes to host insect cuticle. Appl. Environ. Microbiol.54, 1795–1805 (1988).ArticleADSCASPubMedPubMed CentralGoogle Scholar
Boucias, D. G. & Pendland, J. C. The Fungal Spore and Disease Initiation in Plants and Animals 101–127 (Springer, 1991).BookGoogle Scholar
Doss, R. P., Potter, S. W., Chastagner, G. A. & Christian, J. K. Adhesion of nongerminated Botrytis cinerea conidia to several substrata. Appl. Environ. Microbiol.59, 1786–1791 (1993).ArticleADSCASPubMedPubMed CentralGoogle Scholar
Holder, D. J. & Keyhani, N. O. Adhesion of the entomopathogenic fungus Beauveria (Cordyceps) bassiana to substrata. Appl. Environ. Microbiol.71, 5260–5266 (2005).ArticleADSCASPubMedPubMed CentralGoogle Scholar
Quesada-Moraga, E. & Alain, V. Bassiacridin, a protein toxic for locusts secreted by the entomopathogenic fungus Beauveria bassiana. Mycol. Res.108, 441–452 (2004).ArticleCASPubMedGoogle Scholar
Faria, M., Lopes, R. B., Souza, D. A. & Wraight, S. P. Conidial vigor vs. viability as predictors of virulence of entomopathogenic fungi. J. Invertebr. Pathol.125, 68–72 (2015).ArticlePubMedGoogle Scholar
Petrisor, C. & Stoian, G. The role of hydrolytic enzymes produced by entomopathogenic fungi in pathogenesis of insects mini review. Roman. J. Plant Prot.10, 66–72 (2017). Google Scholar
Tseng, M.-N., Chung, C.-L. & Tzean, S.-S. Mechanisms relevant to the enhanced virulence of a dihydroxynaphthalene-melanin metabolically engineered entomopathogen. PLoS ONE9, e90473 (2014).ArticleADSPubMedPubMed CentralGoogle Scholar
Cheong, P., Glare, T. R., Rostás, M. & Haines, S. R. Microbial-Based Biopesticides 177–189 (Springer, 2016).BookGoogle Scholar
Tillman, P. Parasitism and predation of stink bug (Heteroptera: Pentatomidae) eggs in Georgia corn fields. Environ. Entomol.39, 1184–1194 (2010).ArticleCASPubMedGoogle Scholar
Kellner, R. L. The role of microorganisms for eggs and progeny. in Chemoecology of insect eggs and egg deposition, 149–164 (2002).
Cruz-Avalos, A. M., Bivián-Hernández, M. D. L. Á., Ibarra, J. E. & Del Rincón-Castro, M. C. High virulence of Mexican entomopathogenic fungi against fall armyworm, (Lepidoptera: Noctuidae). J. Econ. Entomol.112, 99–107 (2019).ArticleCASPubMedGoogle Scholar
Idrees, A. et al. Effectiveness of entomopathogenic fungi on immature stages and feeding performance of Fall Armyworm, Spodoptera frugiperda (Lepidoptera: Noctuidae) Larvae. Insects12, 1044 (2021).ArticlePubMedPubMed CentralGoogle Scholar
Khorrami, F., Mehrkhou, F., Mahmoudian, M. & Ghosta, Y. Pathogenicity of three different entomopathogenic fungi, Metarhizium anisopliae IRAN 2252, Nomuraea rileyi IRAN 1020C and Paecilomyces tenuipes IRAN 1026C against the potato tuber moth, Phthorimaea operculella Zeller (Lepidoptera: Gelechiidae). Potato Res.61, 297–308 (2018).ArticleGoogle Scholar
Ahmad, S. Enzymatic adaptations of herbivorous insects and mites to phytochemicals. J. Chem. Ecol.12, 533–560 (1986).ArticleCASPubMedGoogle Scholar
Mullin, C. A. Adaptive relationships of epoxide hydrolase in herbivorous arthropods. J. Chem. Ecol.14, 1867–1888 (1988).ArticleCASPubMedGoogle Scholar
Torrado-León, E., Montoya-Lerma, J. & Valencia-Pizo, E. Sublethal effects of Beauveria bassiana (Balsamo) Vuillemin (Deuteromycotina: Hyphomycetes) on the whitefly Bemisia tabaci (Gennadius) (Hemiptera: Aleyrodidae) under laboratory conditions. Mycopathologia162, 411–419 (2006).ArticlePubMedGoogle Scholar
Tupe, S. G., Pathan, E. K. & Deshpande, M. V. Development of Metarhizium anisopliae as a mycoinsecticide: From isolation to field performance. JoVE125, e55272 (2017). Google Scholar
Senthamizhlselvan, P., Sujeetha, J. A. R. & Jeyalakshmi, C. Growth, sporulation and biomass production of native entomopathogenic fungal isolates on a suitable medium. J. Biopest.3, 466 (2010). Google Scholar
Zhang, S., Gan, Y., Xu, B. & Xue, Y. The parasitic and lethal effects of Trichoderma longibrachiatum against Heterodera avenae. Biol. Control72, 1–8 (2014).ArticleGoogle Scholar
Abbott, W. S. A method of computing the effectiveness of an insecticide. J. Econ. Entomol18, 265–267 (1925).ArticleCASGoogle Scholar
This research was funded by the Bangladesh Academy of Science under BAS-USDA Endowment program (4th Phase BAS-USDA BSMRAU CR-13). The authors also expressed thanks to Entomology Division, Bangladesh Agricultural Research Institute (BARI), Gazipur, Bangladesh for proving supports for egg collection and rearing.
Author information
Authors and Affiliations
Institute of Biotechnology and Genetic Engineering, Bangabandhu Sheikh Mujibur Rahman Agricultural University, Gazipur, BangladeshShah Mohammad Naimul Islam, Md. Zahid Hasan Chowdhury, Mahjabin Ferdaous Mim & Tofazzal Islam
Cotton Research Training and Seed Multiplication Farm, Gazipur, BangladeshMilia Bente Momtaz
Contributions
S.M.N.I. conceptualized the idea, supervised experiments, wrote and edited the manuscript. M.Z.H.C. designed experiments, analyzed data and wrote the manuscript. M.F.M. performed fungal and molecular study, M.B.M. conducted insect bioassay, T.I. contributed in interpretation, reviewed and edited the manuscript. Correspondence and requests for materials should be addressed to S.M.N.I. or T.I.
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Rights and permissions
Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article’s Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/.
The technology developed by researchers at the University of Sydney could revolutionize agricultural loss management due to mouse plague.
In 2021, NSW Farmers predicted that the mouse plague would inflict $1 billion in crop loss in Australia.
The study, published in Nature Sustainability, was led by Ph.D. student Finn Parker, with co-authors from the Sydney Institute of Agriculture and School of Life and Environmental Sciences, Professor Peter Banks, Dr. Catherine Price, and Jenna Bytheway.
According to the research team, spraying diluted wheat germ oil on a wheat crop before and after seeding reduces mice’s ability to successfully steal wheat seeds by 63 percent compared to untreated controls.
Seed loss was decreased by 74 percent if the same solution was applied to the wheat plot before planting. They claim that the mice have figured out how to ignore the wheat odour by the time the crop is sown.
This disinformation strategy may be effective in other agricultural systems since any animal that uses smell to locate food is potentially subject to our capacity to manipulate that smell and impair the animal’s ability to search.
Professor Banks said, “We could reduce mice damage even during plague conditions simply by making it hard for mice to find their food, by camouflaging the seed odor. Because they’re hungry, they can’t spend all their time searching for food that’s hard to find.”
He also said, “When the smell of the seed is everywhere, they’ll just go and look for something else instead of being encouraged to dig. That’s because mice are precise foragers that can smell seeds in the ground and explore exactly where a seed is. However, they can’t do that because everything smells like seeds. This misinformation tactic could work well in other crop systems. Indeed, any animal that finds food by smell is potentially vulnerable to us manipulating that smell and undermining their ability to search.”
Finn Parker said, “The camouflage appeared to last until after the seeds germinated, which is the period of vulnerability when wheat needs to be protected.”
He added that camouflage treatment could be an effective solution for wheat growers, given wheat’s brief vulnerability.
He said, “Most mouse damage occurs when seeds are sown up to germination, just under two weeks later. Mice can’t evolve resistance to the method either because it uses the same odor that mice rely on to find wheat seeds.”
The majority of mouse damage happens between the time seeds are sown and germination or slightly under two weeks later.
In May 2021, 60 plots on a farm 10 kilometers northwest of Pleasant Hills, New South Wales, served as the testing ground for five treatments.
The other three treatments were controls, while two used the wheat germ oil solution.
Similar results were achieved by all control treatments, which sustained noticeably more significant damage than treated plots.
A reasonably affordable by-product of milling is wheat germ oil. The scientists claimed that their solution, consisting of diluted wheat germ oil in water, provides a safe, long-lasting substitute for pesticides and baits.
“If people want to control mice but can’t get numbers down low enough, our technique can be a potent alternative to pesticides or add value to existing methods.” Dr Price said.
The research could aid wheat farmers at a crucial time.
The number of mice is increasing, and wheat is sown in the middle of fall.
According to the Department of Agriculture, the Australian wheat market is anticipated to hit a record high of $15 billion this fiscal year.
Wheat producers may benefit from the research at this critical time. Wheat is sown in the middle of fall, and mouse populations are increasing.
The next step is for the researchers to determine how diluted the concentration can be and still effectively repel mice and how frequently the solution needs to be sprayed on a crop to maintain its efficacy.
According to the Department of Agriculture, the Australian wheat market is anticipated to hit a record high of $15 billion this fiscal year.
(From left) Emily Mackie, Dr Andrew Barrow and Dr Tatiana Soares da Costa.
Newswise — Weed killers of the future could soon be based on failed antibiotics.
A molecule which was initially developed to treat tuberculosis but failed to progress out of the lab as an antibiotic is now showing promise as a powerful foe for weeds that invade our gardens and cost farmers billions of dollars each year.
While the failed antibiotic wasn’t fit for its original purpose, scientists at the University of Adelaide discovered that by tweaking its structure, the molecule became effective at killing two of the most problematic weeds in Australia, annual ryegrass and wild radish, without harming bacterial and human cells.
“This discovery is a potential game changer for the agricultural industry. Many weeds are now resistant to the existing herbicides on the market, costing farmers billions of dollars each year,” said lead researcher Dr Tatiana Soares da Costa from the University of Adelaide’s Waite Research Institute.
“Using failed antibiotics as herbicides provides a short-cut for faster development of new, more effective weed killers that target damaging and invasive weeds that farmers find hard to control.”
Researchers at the University’s Herbicide and Antibiotic Innovation Lab discovered there were similarities between bacterial superbugs and weeds at a molecular level.
They exploited these similarities and, by chemically modifying the structure of a failed antibiotic, they were able to block the production of amino acid lysine, which is essential for weed growth.
“There are no commercially available herbicides on the market that work in this way. In fact, in the past 40 years, there have been hardly any new herbicides with new mechanisms of action that have entered the market,” said Dr Andrew Barrow, a postdoctoral researcher in Dr Soares da Costa’s team at the University of Adelaide’s Waite Research Institute.
It’s estimated that weeds cost the Australian agriculture industry more than $5 billion each year.
Annual ryegrass in particular is one of the most serious and costly weeds in southern Australia.
“The short-cut strategy saves valuable time and resources, and therefore could expedite the commercialisation of much needed new herbicides,” said Dr Soares da Costa.
“It’s also important to note that using failed antibiotics won’t drive antibiotic resistance because the herbicidal molecules we discovered don’t kill bacteria. They specifically target weeds, with no effects on human cells,” she said.
It’s not just farmers who could reap the benefits of this discovery. Researchers say it could also lead to the development of new weed killers to target pesky weeds growing in our backyards and driveways.
“Our re-purposing approach has the potential to discover herbicides with broad applications that can kill a variety of weeds,” said Dr Barrow.
Dr Tatiana Soares da Costa and her team are now looking at discovering more herbicidal molecules by re-purposing other failed antibiotics and partnering up with industry to introduce new and safe herbicides to the market.
Funding for this research was provided by the Australian Research Council through a DECRA Fellowship and a Discovery Project awarded to Dr Tatiana Soares da Costa.
The first author on the paper is Emily Mackie, a PhD student in Dr Soares da Costa’s team, who is supported by scholarships from the Grains and Research Development Corporation and Research Training Program. Co-authors include Dr Andrew Barrow, Dr Marie-Claire Giel, Dr Anthony Gendall and Dr Santosh Panjikar.
The Waite Research Institute stimulates and supports research and innovation across the University of Adelaide and its partners that builds capacity for Australia’s agriculture, food, and wine sectors.
Scientists from Australia’s Queensland University of Technology have submitted the results of their research — a genetically modified Cavendish banana — to regulators for approval, claiming that the fruit could serve as a safety net for the industry, which is suffering from the continued spread of the destructive Panama disease fungus, also known as Fusarium wilt.
The banana variety, known as QCAV-4, has been genetically modified to be resistant to Panama disease tropical race 4, which currently poses a grave threat to the global banana supply. The TR4 strain has had a severe impact on production throughout Southeast Asia, causing the Philippines, one of the world’s leading banana exporters, to slip from second to third place in last year’s global export rankings.
If authorized by regulators, QCAV-4 would become the first genetically modified fruit permitted for cultivation and consumption in Australia, as well as the world’s first approved genetically modified banana variety. However, even if the fruit is given a green light, the research team does not plan to immediately release it for commercial production or consumption. According to professor James Dale, who led the research on QCAV-4, the variety provides a potential remedy for growers in the event that Panama disease wipes out the Australian banana sector.
Cavendish bananas gained popularity after plantations of the previously dominant variety, Gros Michel, were ravaged by the Panama TR1 outbreak in the 1950s, and they now account for approximately half of commercial banana production globally. The TR4 strain, which emerged in Taiwan in the 1990s and quickly spread to China, Indonesia, Malaysia, the Philippines and even northern Australia, is now threatening the Cavendish cultivar, which was previously thought to be resistant to Fusarium wilt. The TR4 strain was also detected in Colombia in 2019, Peru in 2021 and Venezuela in 2023, raising fears about the potential eradication of much of the world’s banana crop, given that Latin America and the Caribbean dominate the global supply. In 2022, approximately 77% of the world’s banana exports originated from Latin America and the Caribbean, followed by 20% from Asia and the remainder from Africa.
QCAV-4 was engineered over 20 years of research by introducing a resistance gene from a wild banana that is immune to TR4 into the Cavendish. “We did a much, much bigger field trial that we planted in 2018, and that’s still going,” Dale said. After four years of trials, the QCAV-4 variety had a 2% infection rate, compared with rates of 95% and 75% in two lots of regular Cavendish plants. “If the disease gets going [in Australia] like it has in the Philippines … we’ve got this banana in the back pocket and we’ll be able to pull it out,” he noted.
In the opinion of Australia’s Office of the Gene Technology Regulator, the recent achievement represents a significant milestone; nonetheless, there are still many steps to be taken. A spokesperson for the regulator stated that “the gene technology regulator will carefully examine any risks to people and the environment posed by the commercial cultivation of the GM banana plants,” adding that a permit to grow GM bananas would only be granted if there is assurance that any risks that arise can be managed effectively. In addition to two stakeholder consultation sessions, there will also be a public consultation, which is scheduled to take place in August.
The approval of genetically modified bananas is subject to fruit and environmental safety assessments conducted by the authorities. Another question is whether the approved fruit will gain the trust of consumers. Previously, when Dale’s trials were underway, industry insiders offered a variety of opinions. Some voiced concern that genetically modified bananas would not be accepted on the market. Opponents of genetically modified fruit also urged seeking out traditionally bred alternatives, including cultivars other than Cavendish, some of which are regarded to be even more nutritious and taste better.
Entomology Today May 30 The more pollen a bumble bee carries, the higher its body temperature rises, a new study confirms. As average temperatures rise amid climate change, bees and their pollination services in natural ecosystems could be threatened. 
Global Plant Protection News 
