Feeds:
Posts
Comments

Archive for the ‘Insects’ Category

Posted in Biological control, Insects on May 27, 2023| Leave a Comment »

Scientific Reports

Biocontrol potential of native isolates of Beauveria bassiana against cotton leafworm Spodoptera litura (Fabricius)

Scientific Reports volume 13, Article number: 8331 (2023) Cite this article

Abstract

The entomopathogenic fungus (EPF), Beauveria bassiana, is reported as the most potent biological control agent against a wide range of insect families. This study aimed to isolate and characterize the native B. bassiana from various soil habitats in Bangladesh and to evaluate the bio-efficacy of these isolates against an important vegetable insect pest, Spodoptera litura. Seven isolates from Bangladeshi soils were characterized as B. bassiana using genomic analysis. Among the isolates, TGS2.3 showed the highest mortality rate (82%) against the 2nd instar larvae of S. litura at 7 days after treatment (DAT). This isolate was further bioassayed against different stages of S. litura and found that TGS2.3 induced 81, 57, 94, 84, 75, 65, and 57% overall mortality at egg, neonatal 1st, 2nd, 3rd, 4th, and 5th instar larvae, respectively, over 7 DAT. Interestingly, treatment with B. bassiana isolate TGS2.3 resulted in pupal and adult deformities as well as decreased adult emergence of S. litura. Taken together, our results suggest that a native isolate of B. bassiana TGS2.3 is a potential biocontrol agent against the destructive insect pest S. litura. However, further studies are needed to evaluate the bio-efficacy of this promising native isolate in planta and field conditions.

Introduction

The reduction of crop losses due to insects is becoming a bigger challenge for the world’s food production. Due to concerns about their impact on human health, the environment, and the food chain, many of the older, less expensive chemical insecticides are no longer being registered1. New technologies like expensive, more selective chemicals and genetic modification are being used, but this increased selection pressure accelerates the evolution of resistance in insect pests. Global agriculture urgently needs more environmentally friendly pest management techniques.

The tobacco caterpillar, Spodoptera litura (Fabricius) (Lepidoptera: Noctuidae), is one of the most devastating pests of 120 crop plants, including cauliflower, groundnuts, cotton, onions, tomatoes, brinjal, turnips, and cabbage2. Each year, it goes through five to six overlapping generations, and if it is not promptly treated, it might cause significant crop losses up to complete destruction3. Insecticides are the most often used method for controlling this problem. Although this is effective in reducing pest populations in the short term, long-term exposure to insecticides may cause S. litura to develop the 3 R’s issues, viz., resistance, resurgence of insects, and residues on crops, like other Noctuidae members4. In addition, the use of pesticides leads to ecological imbalances by destroying non-target organisms and their natural enemies, parasites, and predators. The public’s growing concern over the potential ecological and health risks of synthetic pesticides has shifted the focus of research toward more environmentally benign methods for controlling insect pests5.

Insect-pathogenic or entomopathogenic fungi (EFP) (Fungi: Ascomycota, Order: Hypocreales) cause disease in insects. These entomopathogens are used as biocontrol agents, or “biopesticides,” for the management of insect pests6. They provide an alternative to chemical insecticides for protecting crops7 and reducing the harmful environmental impacts of chemical insecticides8. An increasing number of products based on EPF are being registered as insecticides and used in developed and developing countries like the United States of America, the United Kingdom, Australia, Canada, China, India, etc.8.

Among the members of the genus Hypocreales, Lecanicillium sp., Beauveria sp., and Metarhizium sp. have been effectively used to control aphids, lepidopteron larvae, and other pests9. Among them, Beauveria bassiana (Balsamo) Vuillemin is responsible for causing white muscardine disease in a variety of insects. Beauveria infects the insect by degrading the host cuticle using mechanical and chemical forces, which are particularly advantageous in pest control because direct ingestion of fungal propagules is not needed by insects, thus also becoming active against the non-feeding stages of insects10. In addition, among the cyclic hexadepsipeptide mycotoxins produced by the different EPF, beauvericin, produced by B. bassiana, has shown the most effective larvicidal properties11.

Like other Hypocreales, the species of Beauveria show pleomorphic life stages. They are often described as cryptic fungi, i.e., morphological characteristics are changed in response to the environment, and thus morphological description fails to clarify their systematics at species level12. Nowadays, researchers are using polymerase chain reaction (PCR) based molecular techniques to reconstruct the Beauveria phylogeny for accurate identification of Beauveria species. Among the molecular markers, the internal transcribed spacer (ITS) region of rDNA is considered a universal bar code for fungus identification13. But in case of Hypocreales, ITS analysis produced low resolution in many cases and failed to resolve the phylogeny of Beauveria14. Additional genomic markers like translation elongation factor-1α (TEF) are needed for the species-level determination of Beauveria to be made correctly14.

Although B. bassiana showed a broad spectrum of pathogenicity against a wide range of insects, its bio-efficacy depends on the isolation source and life stages of the target stages. Insecticide resistance and resurgence issues can be effectively addressed by controlling insect pests with local isolates of fungus15. These native isolates also have higher survival and persistence abilities under local environmental conditions16. In conservation agriculture guidelines, it is also important to isolate potential native bioagents to prevent contamination from imported biopesticides. In addition, the pathogenicity of the biocontrol agent differs according to the different life stages of the target insect17. Identification of the more suspectable stage of insects against fungal inoculum increases the bio-efficacy of biological control strategies in field conditions. Therefore, the present investigation was carried out to isolate and molecularly characterize native Beauveria isolates and test their bio-efficacy against different life stages of S. litura.

Results

Isolates of Beauveria

Among the isolated fungal isolates on selective medium, seven isolates showed characteristics of the morphology of Beuaveria species. The single fungal colonies of the isolates were white in color, round, lightly elevated with a powdery appearance, and lightly downy with circular rings. Conidia were hyaline and round. Single cell conidiophores were short, densely clustered, and hyaline (Fig. 1).

figure 1
Figure 1

Molecular identification and phylogeny of Beauveria isolates

The partial sequence datasets of ITS and TEF were processed and analyzed individually through Geneious V.11 software, and accession numbers were obtained from NCBI (Table 1). The genomic ITS and TEF data of seven isolated Beauveria isolates showed BLAST similarity, with many references to B. bassiana in BLAST search results in the NCBI database. The reconstructed maximum likelihood phylogenetic tree of the ITS data set showed that the seven morphologically characteristic isolates were clustered with the reference B. bassiana isolate with a moderate bootstrap support value (60%) (Fig. 2). Furthermore, a tree constructed with the TEF data set showed the maximum support (100%) for the clade containing isolated Beauveria isolates and references to B. bassiana (Fig. 3). Thus, both the ITS and TEF data sets confirmed the isolated strains as B. bassiana.Table 1 NCBI accession numbers of isolated B. bassiana isolates.

Full size table

figure 2
Figure 2
figure 3
Figure 3

Biomass production of the fungal isolates

Overall mean mycelial growth revealed that the fungal isolate TGS2.3 (388.27 ± 10.29 mg/100 mL) exhibited the highest biomass production, and the lowest growth was observed in TGS1.2 (208.8 ± 8.03 mg/100 mL) (Fig. 4).

figure 4
Figure 4

Insect bioassay

Seven days following infection of the 2nd larval instar by seven B. bassiana isolates revealed that TGS2.3 had the highest mortality rates (81.72 ± 2.15%) followed by TGS2.1 (72.40 ± 3.46%), BeauD1 (61.29 ± 1.08%), BeauA1 (51.61 ± 2.15%), KSS1.1 (49.46 ± 4.69%), TGS1.2 (46.59 ± 2.71%), and KSS2.2 (43.73 ± 3.78%) (Fig. 5).

figure 5
Figure 5

The findings implied that the death of 2nd instar larvae of S. litura treated with TGS2.3 and TGS2.1 occurred mostly during the first two days of infection, especially on the first day for TGS2.3. The mortality was caused more gradually from day-one to day-seven by the other Beauveria isolates, viz. BeauA1, BeauD1, KSS1.1, KSS1.2, KSS2.2, and TGS1.2 (Fig. 6).

figure 6
Figure 6

As the first day was when the most deaths occurred, results were statistically analyzed to ascertain which isolates induced the highest day-one mortality (causing high mortality within 24 h of infection). Samples infected with TGS2.3 (56.67 ± 7.02%) had the highest day-one mortality, followed by TGS2.1 (43.33 ± 3.51%) (Fig. 7).

figure 7
Figure 7

Hatchability and neonate larval mortality after TGS2.3 treatment

Egg hatchability was drastically reduced in the TGS2.3-treated eggs compared to the control. The isolate TGS2.3 induced 81.25 ± 2.75% egg mortality, whereas in control it was 18.5 ± 2.65% (Fig. 8). The 7-days post treatment data also revealed that TGS2.3 induced 57.25 ± 6.34% neonatal larval mortality, whereas in control it was 8.25 ± 2.63% (Fig. 9).

figure 8
Figure 8
figure 9
Figure 9

Bioassay against different larval stages of S. litura by B. bassiana isolate TGS2.3

The larvae treated with the TGS2.3 isolate succumbed to fungal infection and showed different mortality rates in various larval stages. The highest mortality was recorded in 1st instar larvae (94.45 ± 4.60%) and the lowest was in 5th instar larvae (56.56 ± 2.07%). The mortality rates in 3rd and 4th instar larvae were statistically similar (Fig. 10).

figure 10
Figure 10

Cumulative mortality over 7 days demonstrates that 1st instar larvae had the highest day-one mortality, which progressively rose until the 4th day. The death of 2nd instar larvae began on day-one and subsequently increased until day-five. The 3rd instar larvae did not die until the 3rd day, and the death rate progressed until the 6th day. The death of larvae in the 4th and 5th instars occurred on the 4th day and subsequently increased until the 7th day (Fig. 11). Overall, the mortality across various time points revealed all larval instars of S. litura to be susceptible to the fungus TGS2.3.

figure 11
Figure 11

Mycosis and sub-lethal effects

The mobility of the infected larvae was reduced. The larvae were stiff and rigid after dying. Within two days of death, the deceased larvae began to produce mycelium. (Fig. 12). The B. bassiana infection was verified by the slides prepared from this fungus’ growth. When compared to control larvae, B. bassiana negatively impacted the emergence of adults from the 2nd, 3rd, 4th, and 5th instars. A smaller number of adults (7.11–37.94%) emerged from fungus treated larvae than from control larvae (94%) (Fig. 13).

figure 12
Figure 12
figure 13
Figure 13

Deformities

The fungal infection caused a wide range of abnormalities. When some of the treated larvae molted into pupae, they did not entirely detach from the exuvium (Fig. 14). Some pupae lacked a completely developed cuticle. When 2nd instar larvae were treated with B. bassiana, they had 9.33 ± 2.08 percent pupal deformities. Similarly, the pupal deformity was 7.67 ± 1.53, 10 ± 2 and 6.67 ± 1.53 percent owing to the treatment of 3rd, 4th, and 5th instar larvae, respectively (Fig. 15). Adults developed from fungus infected larvae had 3.67–10% deformities (Fig. 16) with folded, undeveloped wings (Fig. 17). The control group, however, showed no deformation.

figure 14
Figure 14
figure 15
Figure 15
figure 16
Figure 16
figure 17
Figure 17

Discussion

The tobacco caterpillar (S. litura) is one of the most devastating pests of various crops. Insecticides are the most commonly used method for controlling this problem. The use of pesticides leads to ecological imbalances by destroying non-target organisms and their natural enemies, parasites, and predators. The public’s growing concern over the potential ecological and health risks of synthetic pesticides has shifted the focus of research toward more environmentally benign methods. Among them, B. bassiana causes white muscardine disease in a wide range of insects. Insecticide resistance and resurgence issues can be effectively addressed by controlling insect pests with local isolates of fungus and targeting more suspectable stages of insects.

In this study, seven B. bassiana isolates were isolated from soil samples and reported for the first time in Bangladesh as local isolates. The morphology described by previous studies5,18.was similar to that of our seven isolates. The ITS phylogeny produced a moderate support value for these seven isolates, which confirmed the inadequacy of the ITS analysis that had been previously reported1,14,19. However, ITS could be used for quick screening of a wide range of field isolates because of its PCR amplification efficiency20,21,22 and the availability of reference data23. Further molecular analysis with TEF data supported the phylogenetic position of seven isolates in the B. bassiana clade very strongly and proved its efficiency in resolving phylogenies for Hypocreales fungi1,14,19.

To find the best insect pathogenic B. bassiana isolate, the overall and daily mortality of 2nd instar larvae was investigated to determine the mortality induced by each fungal isolate. The highest mortality rate was induced by B. bassiana isolate TGS2.3 and could be because of higher insect pathogenic properties like conidial adhesion, germination rate, growth condition, or the production of enzymes or secondary metabolites. The very first stage of fungal infection is conidial attachment, and the strength of conidial attachment is a crucial indicator of the virulence of an entomopathogenic fungus. Fungal cell attachment to the cuticle may involve specific receptor-ligand and/or nonspecific hydrophobic and electrostatic mechanisms24,25,26. If the adhesion strength of EPF is weakened, then it could result in the washing off of the conidia from the host, thus preventing the infection27. The fluctuation of virulence among different isolates of B. bassiana may be due to their different levels of hydrophobic nature or their biochemistry.

Secondary metabolite synthesis might let EPF get past the immunological defenses of the insects and hasten mycosis6. According to some research, EPF B. bassiana creates host-specific secondary metabolites that, at low quantities, may result in 50% mortality11,28. The strain TGS2.3, which showed the highest insect mortality rate, may produce biologically active compounds with insecticidal activity against S. liturta. Further investigation is required to determine the bioactive compounds produced by B. bassiana isolate TGS2.3. The investigation and production of these compounds may open up new arrays of possibilities for controlling invasive crop pests.

The parameters, such as conidial germination and the production of hydrolytic enzymes are associated with the virulence of EPF21,29,30,31. A faster germination rate was found to exhibit higher virulence in B. bassiana29. The day-one mortality of TGS2.3 was the highest among all the isolates, which suggested that TGS2.3 has a higher germination rate. Hydrolytic enzymes such as protease, chitinase, and lipase are secreted by EPF to degrade the cuticle of host species to infect them32. Higher enzyme activity may be one of the reasons for the higher virulence of TGS2.3. Further investigation is needed to verify these hypotheses for our high-performing Beauveria candidate, TGS2.3.

The immobility of eggs is the main reason for insect vulnerability to microbial infections33. The nutrient requirement of an egg to develop into a hatchling is excessive, and they are highly targeted by pathogenic microbes at this stage34. This study showed that the eggs of S. litura were highly susceptible to TGS2.3. Similar results were found in previous studies where B. bassiana induced egg mortality in S. frugiperda35,36 and Phthorimaea operculella37. The isolate TGS2.3 also induced mortality in neonate larvae, which is similar to another study conducted by Idrees et al.17.

The mortality of larvae was highest in the 1st instar, and it gradually decreased with the advancement of each stage. The 1st instar larvae experienced 38% higher mortality than the 5th instar larvae. This indicates the decreased susceptibility of larvae with age. Shweta and Simon38 used B. bassiana against S. litura Fab. (Tobacco Caterpillar) in which the 1st and 2nd instar larvae showed higher mortality than the later stages. These variations in mortality between various instars might be attributed to enzymatic activity. According to different studies, detoxification enzyme activity changes significantly across and within developmental stages. The activity is modest in the egg stage, rises with each larval or nymphal instar, and ultimately decreases to zero during pupation39,40.

The EPF isolate TGS2.3 demonstrated sub-lethality over the life stages of S. litura. Pupal and adult deformities were produced as a consequence of the fungal infection in the larval stage. The larvae were unable to adequately transition into pupae. Insect molting has reportedly been hampered by B. bassiana41. Since the development of new cuticles during the molting process heavily depends on nutrients, any stage in the process might be affected if there is a nutritional imbalance in the hemolymph caused by a fungal infection. This sub-lethality of B. bassiana isolate TGS2.3 suggests a relatively prolonged sub-lethal influence of the fungi on S.litura, which may reduce S.litura populations more effectively in addition to direct mortality.

In summary, this study found that, the most potent isolate, TGS2.3, was effective against egg hatching and all stages of S. litura caterpillars and suggested that this fungal isolate could be utilized to target both the hatching and feeding stages of this target insect. Alongside, early stages of larval development of S. litura were more susceptible to fungal infection. The sub-lethal effects also demonstrated that once exposed to an entomopathogen, B. bassiana isolate TGS2.3 has the capability to kill insects at any descendant life stage of insect and reduce adult emergence. This study warrants further in planta evaluation in both laboratory and field conditions to evaluate the bio-efficacy of native B. bassiana isolates precisely. However, the findings of this research provided the potential for developing alternative S. litura pest control techniques as well as for limiting the use of synthetic pesticides, thereby minimizing their detrimental effects on the ecosystem.

Methods

Collection of soil samples

Soil samples were obtained from the Bhawal Sal Forest and agricultural fields in Gazipur, Bangladesh. To construct the composite sample, five different soil samples weighing a total of 250–300 g were mixed from a depth of 10–15 cm using a soil sampler. Until they were all studied, the soil samples were kept in distinct zip-lock bags with labels and maintained at 4 °C in a cold room.

Isolation of fungus

A soil suspension containing five grams of soil and 50 mL of 0.1% Tween 80 was made in a screw-cap plastic tube and incubated at room temperature for 3 h after being sieved through a 5 mm screen. Five inversions of each tube were performed at intervals of 30 min. The tubes were retained for 20 s after incubation to allow for sedimentation, and 100 µL of supernatant from each tube was plated on a Petri plate with Sabouraud dextrose agar (SDA) medium (peptone 10 g/L, agar 10 g/L, dextrose 40 g/L, and CTAB 60 mg/L). To avoid bacterial contamination, streptomycin (30 mg/L) was also added. Following inoculation, all plates underwent a two-week incubation period at 22 °C. Every 2–3 days, plates were checked for recognizable, thick, compact white mycelium development. Hypocreales-like isolates were isolated and sub-cultured.

Morphological study

Both the vegetative and reproductive structures of fungal colonies on SDA were examined using microscopy immediately after sporulation. From the outermost part of the fungal colony, little plaques were transferred to glass slides and inspected under a compound light microscope.

Sub-culture, DNA isolation, and molecular characterization

On SDA agar plates without antibiotics, the fungal isolates were sub-cultured for DNA isolation and sequencing. The procedure described by Islam1 was used to extract the DNA.

Briefly, a little lump of fungal mycelium from a 7-day-old culture was placed in an Eppendorf tube, mashed with a sterile plastic pestle, and then suspended in 1 mL of lysis buffer (400 mM Tris–HCl, pH 8.0, 60 mM EDTA, 150 mM NaCl, and 1% SDS), which was then incubated at 50 °C for 1 h in a heat block. A volume of 150 μL of precipitation buffer (5 M potassium acetate, 60.0 mL; glacial acetic acid, 11.5 mL; distilled water, 28.5 mL) was added in the tube and vortexed shortly, then incubated on ice for 5 min. The supernatant from the centrifugation was transferred to a fresh tube along with 500 mL of isopropanol to precipitate the DNA. After centrifugation at 18,000 rcf for 20 min, the DNA pellet was recovered and washed with 1 mL of 70% ethanol. After being air dried for ten minutes, the DNA pellet was dissolved in 100 µL of Tris–EDTA (TE) buffer. In a nanodrop, the DNA’s purity was examined. Polymerase chain reaction (PCR) was used to amplify the ITS region using the primers ITS1F: CTTGGTCATTTAGAGGAAGTAA and ITS4R: TCCTCCGCTTATTGATATGC in accordance with the profile: denaturation at 90 °C for 2 min, then 35 cycles of denaturation at 95 °C for 30 secs, annealing at 55 °C for 30 secs, extension at 72 °C for 1 min, and finally extension at 72 °C for 15 min1. The 5′-TEF region was amplified using EF1TF (5′-ATGGGTAAGGARGACAAGAC) and EF2TR (5′-GGAAGTACCAGTGATCATGTT) after the profile underwent an initial denaturation at 94 °C for 5 min, followed by 35 cycles at 94 °C for 40 s, 65 °C for 40 s, 72 °C for 2 min, and a final extension at 72 °C for 10 min19. The PCR product was electrophoresed in 1% agarose in 1 × TBE buffer at 120 V with GelRed nucleic acid stain and photographed with a molecular imager under UV light. For sequencing, the PCR products were sent to Macrogen, Korea.

Sequence analysis and phylogenetic tree preparation

The Sanger sequencing data of the fungal isolates were produced, and a BLAST search on the National Center for Biotechnology Information (NCBI) database was completed. The partial sequence datasets of ITS and TEF were submitted to NCBI for getting accession number. The sequences matched reference genome sequences obtained from NCBI. The Geneious V.11’s MAFT plug-in was used for multiple alignments, and the final alignment was fixed manually. Phylogenetic trees were developed by maximum likelihood analysis for the data sets using the Geneious V.11 RAxML plug-in using rapid bootstrapping and searching for the best scoring ML tree from 1000 bootstrap replicates in the GTR-GAMMA model.

Insect rearing

Eggs of S. litura were obtained from the existing culture at the Entomology Division, Bangladesh Agricultural Research Institute (BARI), Gazipur, Bangladesh. Homogenous larvae were obtained from eggs hatched on the same day. The larvae were grown in sterile plastic boxes containing pieces of okra disinfected with 0.5% (v/v) sodium hypochlorite for 10 min, maintained at 25 ± 2 °C and 65 ± 5% RH42.

Production and Collection of Beauveria conidia

Sabouraud’s Dextrose Agar (SDA) medium was used in this study. A 10 mm actively grown culture of B. bassiana was placed individually at the center of the 60 mm petri dish containing 10 mL of solid SDA media43. The inoculated plates were incubated at 28 ºC for 7 days. The conidial suspension of the isolates was then prepared by flooding the dishes with 10 mL of sterile Tween 80 (0.05%), the agar surface was gently scraped with sterile glass rods, and the suspension was collected in sterile 250 mL beakers. The suspension was then adjusted to 50 mL and mixed using a hand mixer to separate and disperse the conidia, and finally the conidial density was adjusted to 1.5 × 108 conidia per ml using a hemocytometer44. Before the bioassay experiment, conidial germination was tested on SDA agar medium.

Growth in liquid medium

A volume of 250 mL Sabouraud’s Dextrose Broth (SDB) was prepared in a 500 mL Schott bottle, and the final pH was adjusted to 6.5. The liquid broths were then inoculated with a 10 mm culture disc of the fungus. Three replications were maintained for all the B. bassiana isolates. The entire setup was kept in a shaker incubator at 25 °C temperature at 120 rpm for 10 days. White cotton ball-type growth was observed after 7 days. The mycelia were then filtered through a pre-weighed filter paper and dried in a hot air oven at 70 °C until a constant weight was obtained. This revealed the biomass production capability of all the fungal isolates 43.

Virulence of B. bassiana isolates against eggs and hatched larvae

Freshly laid egg masses that were 1–2 days old were collected and counted under a dissecting microscope. A batch of 50 eggs was separated using a hairbrush and transferred into a petri dish. A volume of 10 mL of conidial suspension (1.5 × 108 conidia/mL) was made using 0.05% Tween 80. The suspension was then sprayed over the egg masses. For control, only Tween 80 was used. Each treatment was repeated four times. 7 days after the treatment (DAT), the number of hatched and unhatched eggs was counted. The newly hatched larvae were then fed, incubated at 25 ± 2 °C, and monitored for the next 7 days. The mortality of each treatment was carefully recorded17.

Insect bioassay

Freshly laid eggs were collected and hatched to obtain homogenous larvae. The assay was conducted on 2nd instar larvae of S. litura. A set of 10 larvae in triplicate were dipped individually into a 10-mL conidial suspension of Beauveria isolates (1.5 × 108 conidia/mL) for 5 s. After treatment, transferred each set of larvae to a separate, sterile plastic box. To each box, added moist blotting paper and a piece of disinfected okra as feed. Changed the paper and feed on alternate days. At 7 DAT, the mortality of larvae was recorded according to the isolates42.

Evaluation of sublethal effects

Larvae that survived the fungal treatment were further reared until pupation at 25 ± 2 °C and 60–70% relative humidity to see the sublethal activity, such as variation in development, any kind of deformity, and longevity compared to the control. Observations were made on larval and pupal deformity, adult emergence, and any morphological deformity in various developmental stages3.

Statistical analysis

Mortality was corrected by Abbott’s formula45. The percent data were transformed by the arcsine transformation. The data were subjected to an analysis of variance (ANOVA), followed by a comparison of the means of different treatments using the least significant difference (LSD). Analyses were performed using R version 3.4.2.

Data availability

The partial sequence data of ITS and TEF genomic regions of fungal isolates during the current study are available in the NCBI repository under the Accession Numbers OP784778–OP784784 and OP785280–OP785286 (will be available on December 4 2022), respectively. The statistical datasets used and/or analyzed during the current study are available from the corresponding author upon reasonable request.

References

  1. Islam, S. M. N. Systematics, Ecology and Plant Associations of Australian Species of the Genus Metarhizium (Queensland University of Technology, 2018).Book  Google Scholar 
  2. Dhanapal, R., Kumar, D., Lakshmipathy, R., Rani, C. S. & Kumar, V. M. Isolation of indigenous strains of the white halo fungus as a biological control agent against 3rd instar larvae of tobacco caterpillar, Spodoptera litura (Fabricius) (Lepidoptera: Noctuidae). Egypt. J. Biol. Pest Control 30, 1–5 (2020). Google Scholar 
  3. Kaur, S., Kaur, H. P., Kaur, K. & Kaur, A. Effect of different concentrations of Beauveria bassiana on development and reproductive potential of Spodoptera litura (Fabricius). J. Biopest. 4, 161 (2011).CAS  Google Scholar 
  4. Mkenda, P. A. et al. Knowledge gaps among smallholder farmers hinder adoption of conservation biological control. Biocontrol Sci. Tech. 30, 256–277 (2020).Article  Google Scholar 
  5. Dhar, S., Jindal, V., Jariyal, M. & Gupta, V. Molecular characterization of new isolates of the entomopathogenic fungus Beauveria bassiana and their efficacy against the tobacco caterpillar, Spodoptera litura (Fabricius) (Lepidoptera: Noctuidae). Egypt. J. Biol. Pest Control 29, 1–9 (2019).Article  Google Scholar 
  6. Zimmermann, G. Review on safety of the entomopathogenic fungus Metarhizium anisopliae. Biocontrol Sci. Tech. 17, 879–920 (2007).Article  Google Scholar 
  7. Lacey, L. & Goettel, M. Current developments in microbial control of insect pests and prospects for the early 21st century. Entomophaga 40, 3–27 (1995).Article  Google Scholar 
  8. Kabaluk, J. T., Svircev, A. M., Goettel, M. S. & Woo, S. G. The Use and Regulation of Microbial Pesticides in Representative Jurisdictions Worldwide (International Organization for Biological Control of Noxious Animals, 2010). Google Scholar 
  9. Quesada-Moraga, E., Navas-Cortés, J. A., Maranhao, E. A., Ortiz-Urquiza, A. & Santiago-Álvarez, C. Factors affecting the occurrence and distribution of entomopathogenic fungi in natural and cultivated soils. Mycol. Res. 111, 947–966 (2007).Article  PubMed  Google Scholar 
  10. Bateman, R., Douro-Kpindou, O., Kooyman, C., Lomer, C. & Ouambama, Z. Some observations on the dose transfer of mycoinsecticide sprays to desert locusts. Crop Prot. 17, 151–158 (1998).Article  CAS  Google Scholar 
  11. Wang, Q. & Xu, L. Beauvericin, a bioactive compound produced by fungi: A short review. Molecules 17, 2367–2377 (2012).Article  CAS  PubMed  PubMed Central  Google Scholar 
  12. Imoulan, A., Hussain, M., Kirk, P. M., El Meziane, A. & Yao, Y.-J. Entomopathogenic fungus Beauveria: Host specificity, ecology and significance of morpho-molecular characterization in accurate taxonomic classification. J. Asia-Pac. Entomol. 20, 1204–1212 (2017).Article  Google Scholar 
  13. Kõljalg, U. et al. (Wiley, 2013).
  14. Rehner, S. A. et al. Phylogeny and systematics of the anamorphic, entomopathogenic genus Beauveria. Mycologia 103, 1055–1073 (2011).Article  PubMed  Google Scholar 
  15. Goble, T., Dames, J., Hill, M. & Moore, S. Investigation of native isolates of entomopathogenic fungi for the biological control of three citrus pests. Biocontrol Sci. Tech. 21, 1193–1211 (2011).Article  Google Scholar 
  16. Sain, S. K. et al. Compatibility of entomopathogenic fungi with insecticides and their efficacy for IPM of Bemisia tabaci in cotton. J. Pestic. Sci. 44, 97–105 (2019).Article  CAS  PubMed  PubMed Central  Google Scholar 
  17. Idrees, A., Afzal, A., Qadir, Z. A. & Li, J. Bioassays of Beauveria bassiana isolates against the fall armyworm, Spodoptera frugiperda. J. Fungi 8, 717 (2022).Article  Google Scholar 
  18. Glare, T. R. & Inwood, A. J. Morphological and genetic characterisation of Beauveria spp. from New Zealand. Mycol. Res. 102, 250–256 (1998).Article  Google Scholar 
  19. Bischoff, J. F., Rehner, S. A. & Humber, R. A. A multilocus phylogeny of the Metarhizium anisopliae lineage. Mycologia 101, 512–530 (2009).Article  CAS  PubMed  Google Scholar 
  20. White, T. J., Bruns, T., Lee, S. & Taylor, J. Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. PCR Protoc. 18, 315–322 (1990). Google Scholar 
  21. Heale, J. B., Isaac, J. E. & Chandler, D. Prospects for strain improvement in entomopathogenic fungi. Pestic. Sci. 26, 79–92 (1989).Article  Google Scholar 
  22. Vilgalys, R. & Gonzalez, D. Organization of ribosomal DNA in the basidiomycete Thanatephorus praticola. Curr. Genet. 18, 277–280 (1990).Article  CAS  PubMed  Google Scholar 
  23. Lutzoni, F. et al. Assembling the fungal tree of life: Progress, classification, and evolution of subcellular traits. Am. J. Bot. 91, 1446–1480 (2004).Article  PubMed  Google Scholar 
  24. Boucias, D., Pendland, J. & Latge, J. Nonspecific factors involved in attachment of entomopathogenic deuteromycetes to host insect cuticle. Appl. Environ. Microbiol. 54, 1795–1805 (1988).Article  ADS  CAS  PubMed  PubMed Central  Google Scholar 
  25. Boucias, D. G. & Pendland, J. C. The Fungal Spore and Disease Initiation in Plants and Animals 101–127 (Springer, 1991).Book  Google Scholar 
  26. Doss, R. P., Potter, S. W., Chastagner, G. A. & Christian, J. K. Adhesion of nongerminated Botrytis cinerea conidia to several substrata. Appl. Environ. Microbiol. 59, 1786–1791 (1993).Article  ADS  CAS  PubMed  PubMed Central  Google Scholar 
  27. Holder, D. J. & Keyhani, N. O. Adhesion of the entomopathogenic fungus Beauveria (Cordyceps) bassiana to substrata. Appl. Environ. Microbiol. 71, 5260–5266 (2005).Article  ADS  CAS  PubMed  PubMed Central  Google Scholar 
  28. Quesada-Moraga, E. & Alain, V. Bassiacridin, a protein toxic for locusts secreted by the entomopathogenic fungus Beauveria bassiana. Mycol. Res. 108, 441–452 (2004).Article  CAS  PubMed  Google Scholar 
  29. Faria, M., Lopes, R. B., Souza, D. A. & Wraight, S. P. Conidial vigor vs. viability as predictors of virulence of entomopathogenic fungi. J. Invertebr. Pathol. 125, 68–72 (2015).Article  PubMed  Google Scholar 
  30. Petrisor, C. & Stoian, G. The role of hydrolytic enzymes produced by entomopathogenic fungi in pathogenesis of insects mini review. Roman. J. Plant Prot. 10, 66–72 (2017). Google Scholar 
  31. Tseng, M.-N., Chung, C.-L. & Tzean, S.-S. Mechanisms relevant to the enhanced virulence of a dihydroxynaphthalene-melanin metabolically engineered entomopathogen. PLoS ONE 9, e90473 (2014).Article  ADS  PubMed  PubMed Central  Google Scholar 
  32. Cheong, P., Glare, T. R., Rostás, M. & Haines, S. R. Microbial-Based Biopesticides 177–189 (Springer, 2016).Book  Google Scholar 
  33. Tillman, P. Parasitism and predation of stink bug (Heteroptera: Pentatomidae) eggs in Georgia corn fields. Environ. Entomol. 39, 1184–1194 (2010).Article  CAS  PubMed  Google Scholar 
  34. Kellner, R. L. The role of microorganisms for eggs and progeny. in Chemoecology of insect eggs and egg deposition, 149–164 (2002).
  35. Cruz-Avalos, A. M., Bivián-Hernández, M. D. L. Á., Ibarra, J. E. & Del Rincón-Castro, M. C. High virulence of Mexican entomopathogenic fungi against fall armyworm, (Lepidoptera: Noctuidae). J. Econ. Entomol. 112, 99–107 (2019).Article  CAS  PubMed  Google Scholar 
  36. Idrees, A. et al. Effectiveness of entomopathogenic fungi on immature stages and feeding performance of Fall Armyworm, Spodoptera frugiperda (Lepidoptera: Noctuidae) Larvae. Insects 12, 1044 (2021).Article  PubMed  PubMed Central  Google Scholar 
  37. Khorrami, F., Mehrkhou, F., Mahmoudian, M. & Ghosta, Y. Pathogenicity of three different entomopathogenic fungi, Metarhizium anisopliae IRAN 2252, Nomuraea rileyi IRAN 1020C and Paecilomyces tenuipes IRAN 1026C against the potato tuber moth, Phthorimaea operculella Zeller (Lepidoptera: Gelechiidae). Potato Res. 61, 297–308 (2018).Article  Google Scholar 
  38. Shweta, A. & Simon, S. Efficacy of Beuveria bassiana on different larval instars of tobacco caterpillar (Spodoptera litura Fab.). Int. J. Curr. Microbiol. Appl. Sci. 6, 1992–1996. https://doi.org/10.20546/ijcmas.2017.608.237 (2017).Article  CAS  Google Scholar 
  39. Ahmad, S. Enzymatic adaptations of herbivorous insects and mites to phytochemicals. J. Chem. Ecol. 12, 533–560 (1986).Article  CAS  PubMed  Google Scholar 
  40. Mullin, C. A. Adaptive relationships of epoxide hydrolase in herbivorous arthropods. J. Chem. Ecol. 14, 1867–1888 (1988).Article  CAS  PubMed  Google Scholar 
  41. Torrado-León, E., Montoya-Lerma, J. & Valencia-Pizo, E. Sublethal effects of Beauveria bassiana (Balsamo) Vuillemin (Deuteromycotina: Hyphomycetes) on the whitefly Bemisia tabaci (Gennadius) (Hemiptera: Aleyrodidae) under laboratory conditions. Mycopathologia 162, 411–419 (2006).Article  PubMed  Google Scholar 
  42. Tupe, S. G., Pathan, E. K. & Deshpande, M. V. Development of Metarhizium anisopliae as a mycoinsecticide: From isolation to field performance. JoVE 125, e55272 (2017). Google Scholar 
  43. Senthamizhlselvan, P., Sujeetha, J. A. R. & Jeyalakshmi, C. Growth, sporulation and biomass production of native entomopathogenic fungal isolates on a suitable medium. J. Biopest. 3, 466 (2010). Google Scholar 
  44. Zhang, S., Gan, Y., Xu, B. & Xue, Y. The parasitic and lethal effects of Trichoderma longibrachiatum against Heterodera avenae. Biol. Control 72, 1–8 (2014).Article  Google Scholar 
  45. Abbott, W. S. A method of computing the effectiveness of an insecticide. J. Econ. Entomol 18, 265–267 (1925).Article  CAS  Google Scholar 

Download references

Acknowledgements

This research was funded by the Bangladesh Academy of Science under BAS-USDA Endowment program (4th Phase BAS-USDA BSMRAU CR-13). The authors also expressed thanks to Entomology Division, Bangladesh Agricultural Research Institute (BARI), Gazipur, Bangladesh for proving supports for egg collection and rearing.

Author information

Authors and Affiliations

  1. Institute of Biotechnology and Genetic Engineering, Bangabandhu Sheikh Mujibur Rahman Agricultural University, Gazipur, BangladeshShah Mohammad Naimul Islam, Md. Zahid Hasan Chowdhury, Mahjabin Ferdaous Mim & Tofazzal Islam
  2. Cotton Research Training and Seed Multiplication Farm, Gazipur, BangladeshMilia Bente Momtaz

Contributions

S.M.N.I. conceptualized the idea, supervised experiments, wrote and edited the manuscript. M.Z.H.C. designed experiments, analyzed data and wrote the manuscript. M.F.M. performed fungal and molecular study, M.B.M. conducted insect bioassay, T.I. contributed in interpretation, reviewed and edited the manuscript. Correspondence and requests for materials should be addressed to S.M.N.I. or T.I.

Corresponding authors

Correspondence to Shah Mohammad Naimul Islam or Tofazzal Islam.

Ethics declarations

Competing interests

The authors declare no competing interests.

Additional information

Publisher’s note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Rights and permissions

Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article’s Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/.

Reprints and Permissions

About this article

Cite this article

Islam, S.M.N., Chowdhury, M.Z.H., Mim, M.F. et al. Biocontrol potential of native isolates of Beauveria bassiana against cotton leafworm Spodoptera litura (Fabricius). Sci Rep 13, 8331 (2023). https://doi.org/10.1038/s41598-023-35415-x

Download citation

  • Received29 November 2022
  • Accepted17 May 2023
  • Published23 May 2023
  • DOIhttps://doi.org/10.1038/s41598-023-35415-x

Share this article

Anyone you share the following link with will be able to read this content:

Provided by the Springer Nature SharedIt content-sharing initiative

Subjects

Download PDF

Scientific Reports (Sci Rep) ISSN 2045-2322 (online)

Read Full Post »

Chinese research: Preventing spread of Brown marmorated stink bug in New Zealand

Posted in Biological control, Emerging/invasive pests, Insects, Natural enemies on May 24, 2023| Leave a Comment »

Chinese research offers promise to prevent spread of Brown marmorated stink bug in New Zealand

Zespri International is funding research to understand the lifecycle of the brown marmorated stink bug (Halyomorpha halys) on organic and conventional kiwifruit in China, part of its native range. Now, Chinese scientists are making progress which could help prevent the brown marmorated stink bug spreading in New Zealand.

Dr Jin-ping Zhang, Senior Project Scientists based at CABI’s center in China, has also been busy testing the efficacy of a natural enemy for the brown marmorated stink bug; the parasitoid Asian Samurai Wasp (Trissolcus japonicus).

The brown marmorated stink bug is the kiwifruit industry’s second-most unwanted biosecurity threat after fruit flies; the risk of it entering New Zealand is considered extreme. Dr Zhang’s research has so far shown that brown marmorated stink bug egg periods optimum for parasitoid release are May to middle June and from early July to middle August. Dr Zhang adds that three continuous releases of the natural enemy in May was effective, for example, to control the first generation of eggs – therefore, keeping the fruit damage at a low level until the end of July.

Source: blog.invasive-species.org

Publication date: Wed 24 May 2023

Read Full Post »

Africa: Maize crop is at risk from devastating fall armyworm pest

Posted in Emerging/invasive pests, Insects on February 8, 2023| Leave a Comment »

JANUARY 31, 2023

Almost all of Africa’s maize crop is at risk from devastating fall armyworm pest, study reveals

by CABI

Almost all of Africa's maize crop is at risk from devastating fall armyworm pest, study reveals
Fall armyworm is a major threat to the majority of Africa’s maize crops. Credit: CABI

Almost all of Africa’s maize crop is at risk from the devastating fall armyworm pest (Spodoptera frugiperda) according to new research published in the journal Frontiers in Insect Science.

https://ffcac719cd00a3719979a378addce07c.safeframe.googlesyndication.com/safeframe/1-0-40/html/container.html

Scientists from the University of Minnesota’s GEMS Informatics Center, and CABI’s Dr. Roger Day, Global Advisor, Plant Health, have highlighted how almost the entire African maize crop is grown in areas with climates that support seasonal infestations of the pest.

The researchers assembled 3,175 geo-tagged occurrences of the fall armyworm worldwide and use that data in conjunction with information about the physiological requirements of the pest to spatially assess its global climate suitability.

They also found that almost 92% of Africa’s maize growing areas support year-round growth of fall armyworm. Alarmingly, 95% of the crop is also deemed climatically suitable for fall armyworm and at least three or more pests such as the maize stalk borer, Western corn rootworm and Asiatic witchweed.

Starkly, over half (52.5%) of the African maize area believed suitable for fall armyworm is at further risk from an additional nine pests, while over a third (38.1%) of the area is susceptible to an additional 10 pests.

Dr. Senait Senay, lead author from the University of Minnesota, said, “The spatial concurrence of climatically suitable locations for these pests raises the production risk for farmers well above the risks posed from fall armyworm alone.”

“This constitutes an exceptionally risky production environment for African maize producers, with substantive and complex implications for developing and implementing crop breeding, biological, chemical and other crop management strategies to help mitigate these multi-peril risks,” notes Professor Phil Pardey, co-lead author of the study.

Outbreaks of fall armyworm in Africa were first observed in southwest Nigerian maize fields in January 2016 and thereafter in Benin, Togo São Tome and Principe. Since then, the pest has spread to more than 40 African countries including Ethiopia, Kenya and Tanzania.

In 2021, CABI scientists conducted the first comprehensive study on the economic impact of a range of Invasive Alien Species (IAS) on Africa’s agricultural sector which they estimated to be USD $65.58 billion a year. They established that the fall armyworm alone caused the highest annual yield losses at USD $9.4 billion.

Dr. Day said, “Climates that favor maize production are also seasonably suitable for fall armyworm infestations—not just in Africa. Indeed, around half of the world’s maize area, mostly in the moist and warm tropical locales, is also likely to sustain the development of fall armyworm year-round.”

“Strategies to deal with fall armyworm, or any other crop pest are best conceived and executed from a multi-peril pest perspective—especially as part of an Integrated Pest Management practice—rather than a piece-meal, pest-by-pest approach.”

The study, which is part of a broader GEMS informatics effort concerning Global Pest Risk Analytics, concludes by suggesting that crop management may benefit more from genetic solutions and environmentally friendly biological control agents.

These, they say, require less frequent and timely trips to markets to secure necessary fungicides/insecticides as seasonal pest infestations unfold.

However, they also admit that while IPM practices constitute another, often complementary, strategy for controlling crop pests—especially in tropical regions where natural enemies can have year-round survivability, IPM is not widely adopted in the developing world.

Dr. Senay added, “A multi-peril pest risk approach can be used to both benchmark future multi-peril pest risk assessments—under prospective changes in climate—while also informing current and nearer-term strategies to target market and government resources.”

“This can be done in ways which have the most beneficial effect in mitigating the complex of crop pests that pose the most risk for farmers growing particular crops in particular locales.”

More information: Senait D. Senay et al, Fall armyworm from a maize multi-peril pest risk perspective, Frontiers in Insect Science (2022). DOI: 10.3389/finsc.2022.971396

Provided by CABI

Explore further

Opportunities for natural enemy to fight devastating fall armyworm

Read Full Post »

Warning: Insects Damaging Plants at Unprecedented Levels

Posted in Climate change, Insects, Pest damage on December 23, 2022| Leave a Comment »

Scientists Warn of Insects Damaging Plants at Unprecedented Levels

TOPICS:FossilsInsectPaleontologyUniversity Of Wyoming

By UNIVERSITY OF WYOMING DECEMBER 11, 2022

Insect-Damaged Leaf Fossil

This fossil leaf from Wyoming’s Hanna Basin, about 54 million years old, shows damage by insects. Credit: Lauren Azevedo-Schmidt

Insects today are causing unprecedented levels of damage to plants, even as insect numbers decline, according to new research led by scientists from the University of Wyoming.

In the first-of-its-kind study, insect herbivore damage of modern-era plants was compared with that of fossilized leaves from as far back as the Late Cretaceous period, nearly 67 million years ago. The findings were recently published in the prestigious journal Proceedings of the National Academy of Sciences.

“Our work bridges the gap between those who use fossils to study plant-insect interactions over deep time and those who study such interactions in a modern context with fresh leaf material,” says the lead researcher, University of Wyoming Ph.D. graduate Lauren Azevedo-Schmidt, now a postdoctoral research associate at the University of Maine. “The difference in insect damage between the modern era and the fossilized record is striking.”

Azevedo-Schmidt conducted the research along with the University of Wyoming Department of Botany and Department of Geology and Geophysics Professor Ellen Currano, and Assistant Professor Emily Meineke of the University of California-Davis.

Lauren Azevedo-Schmidt Fossilized Plant Search

Lauren Azevedo-Schmidt searches for fossilized plants in Wyoming’s Hanna Basin in a deposit that is about 60 million years old. She and other researchers compared fossil leaves with modern samples and found higher rates of insect damage today. Credit: Lauren Azevedo-Schmidt

In the study, fossilized leaves with insect feeding damage from the Late Cretaceous through the Pleistocene era, a little over 2 million years ago, were examined. They were then compared with leaves collected from three modern forests by Azevedo-Schmidt. The detailed research looked at different types of damage caused by insects, finding marked increases in all recent damage compared to the fossil record.

“Our results demonstrate that plants in the modern era are experiencing unprecedented levels of insect damage, despite widespread insect declines,” wrote the scientists, who suggest that the disparity can be explained by human activity.

Although more research is necessary to determine the precise causes of increased insect damage to plants, the scientists say a warming climate, urbanization, and the introduction of invasive species likely have had a major impact.

“We hypothesize that humans have influenced (insect) damage frequencies and diversities within modern forests, with the most human impact occurring after the Industrial Revolution,” the researchers wrote. “Consistent with this hypothesis, herbarium specimens from the early 2000s were 23 percent more likely to have insect damage than specimens collected in the early 1900s, a pattern that has been linked to climate warming.”

But climate change doesn’t fully explain the increase in insect damage, they say.

“This research suggests that the strength of human influence on plant-insect interactions is not controlled by climate change alone but, rather, the way in which humans interact with the terrestrial landscape,” the researchers concluded.

Reference: “Insect herbivory within modern forests is greater than fossil localities” by Lauren Azevedo-Schmidt, Emily K. Meineke and Ellen D. Curran, 10 October 2022, Proceedings of the National Academy of Sciences.
DOI: 10.1073/pnas.2202852119

Read Full Post »

Need to stabilise the global climate for insect survival

Posted in Climate change, Insects on November 30, 2022| Leave a Comment »

Now, an international team of experts is providing a convincing overview of the role of climate change and climatic extremes in driving insect decline.

11-07-2022

Insects need urgent help to survive climate change

ByKatherine Bucko

Earth.com staff writer

While the scientific community has previously warned about an alarming decline in insect populations, not much has been done to address this issue on a global scale. Now, an international team of experts is providing a convincing overview of the role of climate change and climatic extremes in driving insect decline. 

“If no action is taken to better understand and reduce the impact of climate change on insects, we will drastically limit our chances of a sustainable future with healthy ecosystems.” This is the warning from a paper composed by 70 scientists from 19 countries around the world as part of the of the Scientists’ Warning series. 

“Climate change aggravates other human-mediated environmental problems,” said lead author Jeffrey Harvey from the Netherlands Institute of Ecology. “Including habitat loss and fragmentation, various forms of pollution, overharvesting and invasive species.”

Insects play critical roles in many ecosystems, making this problem incredibly urgent, as ecosystem loss is on the rise.

“The gradual increase in global surface temperature impacts insects in their physiology, behaviour, phenology, distribution and species interactions. But also, more and longer lasting extreme events leave their traces,” said Harvey.

While fruit flies, butterflies and flour beetles have the capacity to survive heat waves, they can become sterilized and unable to reproduce. Bumblebees, in particular, are very sensitive to heat, and climate change is now considered the main factor in the decline of several North American species.

“Cold-blooded insects are among the groups of organisms most seriously affected by climate change, because their body temperature and metabolism are strongly linked with the temperature of the surrounding air,” said Harvey.

Insects also play a critical role in supporting the global economy through services such as pollination, pest control, nutrient cycling and decomposition of waste. These vitally important services help to sustain humanity and provide billions of dollars annually to the global economy. 

“The late renowned ant ecologist Edward O. Wilson, once argued that ‘it is the little things that run the world’. And they do!’” said Harvey.

The ability for insects to adapt to global warming is further impacted by human threats such as habitat destruction and pesticides. Heatwaves and droughts can drastically harm insect populations in the short term, making insects less able to adapt to more gradual warming.  

The paper includes solutions and management strategies. Individuals can help by caring for different wild plants, providing food and shelter for insects during climate extremes. Reducing the use of pesticides and other chemicals is also recommended. 

“Insects are tough little critters and we should be relieved that there is still room to correct our mistakes,” said Harvey. “We really need to enact policies to stabilise the global climate. In the meantime, at both government and individual levels, we can all pitch in and make urban and rural landscapes more insect-friendly.”

Check us out on EarthSnap, a free app brought to you by Eric Ralls and Earth.com.

—

By Katherine Bucko, Earth.com Staff Writer

Read Full Post »

Florida, USA: Thrips Show Promise in Controlling the Invasive Brazilian Peppertree in Florida

Posted in Emerging/invasive pests, Insects on November 12, 2022| Leave a Comment »

USDA ARS Banner

Thrips Show Promise in Controlling the Invasive Brazilian Peppertree in Florida

USDA Agricultural Research Service sent this bulletin at 10/12/2022 09:27 AM EDT

View as a webpageARS News ServiceARS News
ServiceBrazilian peppertree thrips larvae and adults feed on a Brazilian peppertreeBrazilian peppertree thrips larvae and adults feed on a Brazilian peppertree. (Photo by Dale Halbritter)Thrips Show Promise in Controlling the Invasive Brazilian Peppertree in FloridaFor media inquiries contact: Jessica Ryan, (301) 892-0085October 12, 2022Brazilian peppertree thrips (Pseudophilothrips ichini) showed promise as biological control agents for invasive Brazilian peppertree populations in Florida according to a recent study published in the Florida Entomologist.Thrips are common insect pests on horticultural plants, but specialized Brazilian peppertree thrips from South America feed exclusively on the Brazilian peppertree’s leaves and stem tips. Their feeding results in reducing the peppertree’s growth rate, plant height, number of leaves, and green stems as well as fruit and flower production.Scientists from the United States Department of Agriculture’s Agricultural Research Service (ARS) collaborated with University of Florida and Florida Department of Food and Consumer Services researchers to mass produce and release thrips throughout 567 sites in Florida between May 2019 and December 2021.The study results show that these thrips persisted in 60 percent of the survey sites for at least one generation as indicated by the recovery of adult thrips at least 60 days after their release. “This is a significant finding, because it indicates the thrips have a self-sustaining population at up to 60 percent,” said Gregory Wheeler, research entomologist at the ARS Invasive Plant Research Laboratory in Fort Lauderdale, Florida.Native to South America, the Brazilian peppertree is a woody and evergreen shrub known for its bright red berries and green foliage. This invasive species grows in dense thickets in invaded ranges and crowds native vegetation. Its fruit is toxic when consumed by wildlife, and many people have allergic reactions to its pollen and sap. In the U.S., the Brazilian peppertree has made its way to California, Florida, Hawaii, and Texas. In Florida alone, the Brazilian peppertree tree has colonized most of the state’s peninsula and covers more than 700,000 acres of land.Use of biological control agents can be a solution for land managers seeking to control invasive populations, according to Wheeler.”Biological control agents like thrips can be a cost-effective and environmentally friendly means of pest control that can be a part of an integrated approach that includes a number of different tactics,” said Wheeler.Thrips are the first biological control agent for this invasive species released in Florida. Researchers will continue field releases and assessments to determine thrips’ effectiveness.The Agricultural Research Service is the U.S. Department of Agriculture’s chief scientific in-house research agency. Daily, ARS focuses on solutions to agricultural problems affecting America. Each dollar invested in U.S. agricultural research results in $20 of economic impact.Interested in reading more about ARS research? Visit our news archiveU.S. DEPARTMENT OF AGRICULTURE
Agricultural Research Service

Read Full Post »

Oregon, USA: Invasive brown marmorated stink bug threaten crops

Posted in Biological control, Biotic stress, Emerging/invasive pests, Insects, Pests on November 11, 2022| Leave a Comment »

Fruit and vegetable crops in the Willamette Valley have been affected

USDA ARSWFP-ARS-BMSB.jpg

One promising biological approach is the samurai wasp (Trissolcus japonicus),

The brown marmorated stink bug has increased this year.

Fruit and vegetable crops in the Willamette Valley have been affected.

Kym Pokorny | Nov 11, 2022

Jan 18, 2023 to Jan 20, 2023

https://c71d1d9bfc4c1ba1e62a1071cab6352e.safeframe.googlesyndication.com/safeframe/1-0-39/html/container.html

The amount of invasive brown marmorated stink bugs in 2022 tops anything seen in Oregon for at least five years and poses a serious threat to Oregon crops and garden plants, according to Oregon State University Extension Service’s orchard crop specialist.

Nik Wiman, an associate professor in the College of Agricultural Sciences, said fruit and vegetable crops in the Willamette Valley have been affected.

https://c71d1d9bfc4c1ba1e62a1071cab6352e.safeframe.googlesyndication.com/safeframe/1-0-39/html/container.html

“It’s unusual for brown marmorated stink bugs to feed on fruit and vegetable crops,” he said. “There has been a lot of damaging populations of BMSB in hazelnuts orchards. Growers use preventative measures so we’re surprised we’ve seen so many.”

It’s unclear why the population exploded this year, Wiman said. Like other insects, the population of the shield-shaped brown marmorated stink bug (BMSB) varies from year to year depending on climatic factors. The extremely wet spring most likely contributed to it, but the increase could also be attributed to a natural cycle.

Native to Asia, BMSB was introduced on the U.S. East Coast in the late 1990s – probably by ship – and has spread to almost every state in the country, including Oregon in 2004. The insect feeds on at least 170 plants, particularly vegetables, pears, apples and hazelnuts, but also ornamentals. Its name describes the odor they emit when they’re crushed.

Oregon’s hazelnut industry, valued at $132 million in 2020, is one of the state’s crops hardest hit by the invasive bug, according to the Oregon Department of Agriculture. The state’s problem echoes the situation in Turkey – the world’s leader in hazelnut production – as well as Italy and the country of Georgia, said Wiman, who researches alternative practices for controlling BMSB, including biological control, habitat manipulation, trap crops and barriers.

Samurai wasp

One promising biological approach is the samurai wasp (Trissolcus japonicus), an insect native to areas of Asia where it keeps the indigenous BMSB population under control. Scientists have discovered the wasp in the United States and Oregon, where it was initially distributed across the state by Wiman and a team of scientists at OSU and elsewhere.  The Oregon Department of Agriculture is now leading the effort.

The parasitic wasp hunts for the egg masses of the stink bug and lays an egg inside each egg in the mass. The wasp develops inside the egg, effectively killing the stink bug, and then chews its way out. OSU Extension has a short publication on the wasp and its effect on the stink bug.

In addition to agricultural crops, the stink bug shows up in homes in autumn when they are looking for a warm, dry place for winter.

“We’ve done analysis of reports we get from people,” Wiman said. “We’ve looked at timing and by far and away we get the most BMSB reports in the fall. Adults are at peak and are trying to get into houses. Warm fall weather gives more opportunity to get into buildings. They can be very annoying when they are coming into homes, and they may fly around inside your house all winter. Then they come out in spring.”

Wiman advises homeowners to seal all cracks where the stink bug can enter and vacuum up inside infestations. On outdoor buildings, washing them off with a strong shot of water will keep some at bay. If they come back, spray them again.

Farmers and homeowners can serve a key role in samurai wasp research by collecting possible brown marmorated stink bug egg masses and reporting them.

[Kym Pokorny is a communication specialist at OSU.]

Source: Oregon State University

TAGS: CROPS

Read Full Post »

‘Insect apocalypse’ amid climate change

Posted in Climate change, Insects on November 10, 2022| Leave a Comment »

Scientists warn of ‘insect apocalypse’ amid climate change

insect egg
Credit: CC0 Public Domain

An emerging “insect apocalypse” will have radical effects on the environment and humankind, an Australian scientist has warned.

An international study on the future of insects under climate change scenarios has found the loss of insects will drastically reduce the ability of humankind to build a sustainable future.

Co-author William Laurance, of James Cook University in Australia, said the biosphere had already warmed by about 1.1 degrees Celsius since industrialization. It is projected to warm a further 2–5 degrees Celsius by 2100 unless greenhouse gas emissions are significantly reduced.

An insect’s small body size and inability to regulate their own body temperature made them particularly susceptible to changing temperature and moisture levels, Laurance said in a Tuesday statement.

“A growing body of evidence shows many populations of insects are declining rapidly in many places. These declines are of profound concern, with terms like an emerging ‘insect apocalypse’ being increasingly used by the media and even some scientists to describe this phenomenon,” Laurance said.

“The loss of insects works its way up the food chain, and may already be playing an important role in the widespread decline of their consumers, such as insect-eating birds in temperate environments.”

Insects are important parts of biodiversity and provide services to the wider environment—including pollination, pest control and nutrient recycling—all of which are beneficial to other creatures, including humans, Laurance said.

The study found climate change amplified the effects of other factors threatening insect populations, such as pollution, habitat loss and predation.

“It’s essential to manage and restore habitats that make them as ‘climate-proof’ as possible and enable insects to find refuges in which they can ride out extreme climatic events,” Laurance said.

“The evidence is clear and striking. We need to act now to minimize impacts on insect populations—we know how to do it, but the decision making and requisite funding keep getting pushed down the road,” Laurance added.

2022 dpa GmbH.

Distributed by Tribune Content Agency, LLC.

Explore further

Temperate insects as vulnerable to climate change as tropical species

Read Full Post »

Landscape Fire Smoke Affects Insects

Posted in Abiotic stress, Insects on November 8, 2022| Leave a Comment »

New Meta-Analysis Examines How Landscape Fire Smoke Affects Insects

ENTOMOLOGY TODAY  LEAVE A COMMENT

Research has found a variety of impacts on insects, both positive and negative, caused by smoke from wildfires and prescribed burns, but a new review of past studies shows we have much to learn. (Photo by Sebastian Werner via Flickr, CC BY 2.0)

By Laura Kraft, Ph.D.

Laura Kraft, Ph.D.

During the 2019-2020 bush fire in Australia, some entomologists wanted to calculate the area burned and the total number of insects that may have been killed during the blaze. While those calculations were based solely on the charred acres, a new research review published in September in Environmental Entomology attempts to map previous research on how landscape fire smoke, including smoke from bush fires like the one in Australia, affect insects—and where gaps lie in knowledge that new research could fill.

Yanan Liu, a Ph.D. student in geography at King’s College London, led the study. She and colleagues first searched through more than 9,000 articles that linked to their search terms related to smoke. After carefully parsing through the literature and removing articles on smoke from sources like cigarettes or vehicles, the team ended up with 42 total publications focused only on landscape fire smoke, which includes wildfires, prescribed burns, and agricultural residue burns. The selected studies spanned 15 different countries.

Yanan Liu

The papers represented show an inordinate amount of research that tracks how smoke affects beetles, with fewer papers focusing on effects on flies, bees, and butterflies. And, Liu’s team found, the general consensus is that there is no general consensus. Landscape fire smoke both positively and negatively affects insects in a variety of different ways. Says Liu, “I expected the smoke to repel all the insects or have a negative effect, but it depends on the insect order. For example, beetles are actually attracted [to landscape-based fire].”

For some of those beetles, though, including the red flour beetle (Tribolium castaneum) and the rice weevil (Sitophilus oryzae), smoke produced from burning cow dung and neem leaves caused high mortality. Smoke produced from rice paddy burning with high carbon dioxide levels at 5,000 parts per million may have also caused 50 percent mortality in the rice weevil and the lesser grain borer (Rhyzopertha dominica) in one study.

When it doesn’t cause death, particulate matter in smoke appears to block the antennal receptors in some insects, including bees. While European honey bees (Apis mellifera) famously show signs of decreased aggression in response to smoke (which is why beekeepers have long used smoke to work in hives), other stinging species, like the Sonoran bumble bee (Bombus pensylvanicus sonorous) and the western yellowjacket (Vespula pensylvanica), also show a dramatic reduction in attacks due to smoke. “We normally use smoke to repel bees if you want to get honey from the bees’ home … and when you use a smoker, the bees fly away from their nest. If this smoke influences some insects and changes their behavior, maybe smoke from the landscape fire or from wildfire changes the behavior of other insects,” says Liu.

There are some signs that landscape fire smoke may affect insect flight and migration. Some butterflies initiate flight in response to savanna fires, and painted lady butterflies (Vanessa cardui) show decreased flight performance when subjected to smoke. Other insects have been shown to delay their flights until sky conditions are clear, which may be due to smoke affecting the polarization of light that the insects would typically follow.

Some insects benefit from landscape fire smoke and are attracted to it. This includes wood-burrowing beetles from insect families Cerambycidae and Buprestidae. Some species of these beetles are attracted to smoke and rush back to damaged trees to reproduce at higher rates and colonize the newly damaged trees.

In addition, black army cutworm moths (Actebia fennica) doubled the amount of eggs they laid in response to the volatiles produced from burning vegetation due to increased reproductive hormones. And they weren’t the only butterflies to benefit. During severe forest fires in Borneo in 1997and 1998, most insect species declined, except the butterfly Jamides celeno (family: Lycaenidae) that increased its abundance out of all butterflies in the region from just 5 percent to 50 percent of the assemblage.

Of the 38 studies that examined landscape-fire smoke impacts on insects included in a new research review in Environmental Entomology (and which were associated with individual countries), more than half (20) looked at fire in the United States or Canada. (Number of studies and number of insect species per country noted in parentheses.) (Image originally published in Liu et al 2022, Environmental Entomology)

Despite having publications from five of the seven continents, one of the trends that the researchers found was a clear bias toward papers from the United States and Canada, with a moderate amount from Australia and far fewer stretched out over developing countries in Africa and Asia. While Western readers are familiar with many wildfires in those regions that hit major news outlets, Liu’s team points out that average levels of particulate matter—the small, often toxic particles making up smoke—are often even more highly concentrated in other regions; a study published last year identified central and west Africa and south and southeast Asia as regions most affected by landscape fire smoke globally. Clearly, there is need to increase research studying how landscape fire smoke affects insect populations in these understudied regions.

These few examples of how landscape smoke dramatically affects some insect populations, both positively and negatively, show that more research is needed to expand our understanding of the effects of landscape fire smoke—for a wider diversity of insects, in a broader range of behaviors, and over a larger geographic area.

In the meantime, Liu and her colleagues are now chipping away at some of these questions by studying how smoke affects painted lady butterfly flight behavior.

Read More

“Systematic Mapping and Review of Landscape Fire Smoke (LFS) Exposure Impacts on Insects”

Environmental Entomology

Laura Kraft, Ph.D., is an entomologist, science communicator, and world traveler currently based in Orlando, Florida. Email: laurajkraft@gmail.com.

SHARE THIS:

Read Full Post »

How can flying insects and drones tell up from down?

Posted in Artificial intelligence, Insects on October 25, 2022| Leave a Comment »

How can flying insects and drones tell up from down?

Date:October 20, 2022Source:CNRSSummary:For proper operation, drones usually use accelerometers to determine the direction of gravity. Scientists have now shown that drones can estimate the direction of gravity by combining visual detection of movement with a model of how they move. These results may explain how flying insects determine the direction of gravity and are a major step toward the creation of tiny autonomous drones.Share:

FULL STORY

While drones typically use accelerometers to estimate the direction of gravity, the way flying insects achieve this has been shrouded in mystery until now, as they have no specific sense of acceleration. In this study, a European team of scientists1 led by the Delft University of Technology in the Netherlands and involving a CNRS researcher has shown that drones can assess gravity using visual motion detection and motion modelling together.

To develop this new principle, scientists have investigated optical flow, that is, how an individual perceives movement relative to their environment. It is the visual movement that sweeps across our retina when we move. For example, when we are on a train, trees next to the tracks pass by faster than distant mountains. The optical flow alone is not enough for an insect to be able to know the direction of gravity.

However, the research team discovered that it was possible for them to find this direction by combining this optical flow with a modelling of their movement, i.e. a prediction of how they will move. The conclusions of the article show that with this principle it was possible to find the direction of gravity in almost all situations, except in a few rare and specific cases such as when the subject was completely immobile.

During such perfect stationary flights, the impossibility of finding the direction of gravity will destabilize the drone for a moment and therefore put it in motion. This means the drone will regain the direction of gravity at the next instant. So these movements generate slight oscillations, reminiscent of insect flight.

Using this new principle in robotics could meet a major challenge that nature has also faced: How to obtain a fully autonomous system while limiting payload. Future drone prototypes would be lightened by not needing accelerometers, which is very promising for the smallest models of the size of an insect.

Though this theory may explain how flying insects determine gravity, we still need confirmation that they actually use this mechanism. Specific new biological experiments are needed to prove the existence of these neural processes that are difficult to observe in flight. This publication shows how the synergy between robotics and biology can lead to technological advances and new biological research avenues.

Notes

1 This research results from a European collaboration between two laboratories: the Micro Air Vehicle Laboratory at the The Faculty of Aerospace Engineering at the Delft University of Technology in the Netherlands and the Institut des Sciences du Mouvement (CNRS/Aix Marseille Université) in France.

Story Source:

Materials provided by CNRS. Note: Content may be edited for style and length.

Journal Reference:

  1. Guido C. H. E. de Croon, Julien J. G. Dupeyroux, Christophe De Wagter, Abhishek Chatterjee, Diana A. Olejnik, Franck Ruffier. Accommodating unobservability to control flight attitude with optic flow. Nature, 2022; 610 (7932): 485 DOI: 10.1038/s41586-022-05182-2

Cite This Page:

CNRS. “How can flying insects and drones tell up from down?.” ScienceDaily. ScienceDaily, 20 October 2022. <www.sciencedaily.com/releases/2022/10/221020130254.htm>.

Read Full Post »

Insect damage increase through history

Posted in Crop protection, Emerging/invasive pests, Insects, Insects, Pest damage, Pests on October 24, 2022| Leave a Comment »

UMaine News

A photo of a leaf damage
Photo by Sarah Fanning, courtesy of Lauren Azevedo-Schmidt.

Insects cause more damage to leaves in recent history than millions of years ago, study finds 

October 12, 2022 

Insect herbivores have caused more damage to plant matter from leaves in recent history than millions of years ago, according to a new study led by a University of Maine postdoctoral researcher. 

Despite global insect decline and biodiversity loss fueled by human activity, the frequency of leaf damage by insects among forest plants in recent history, post-1955, is more than twice that of vegetation from the Pleistocene, 2.06 million years ago, and the Late Cretaceous period, 66.8 million years ago. The unprecedented increase in insect damage on leaf matter could pose negative effects on plant productivity and forest health.

To conduct their study, Lauren Azevedo-Schmidt, a postdoctoral researcher with UMaine’s Climate Change Institute, and her colleagues collected leaf samples deposited within sediment across three modern forest ecosystems — Harvard Forest in Massachusetts, the Smithsonian Environmental Research Center in Maryland, and La Selva in Costa Rica — and compared them to previously published leaf litter and fossil data. 

The research team, which also includes Emily Meineke of University of California, Davis and Ellen Currano of the University of Wyoming, used radiocarbon dates to verify the ages of modern leaves along with quantifying the frequency and diversity of insect damage in each sample.  

The causes of this increase in leaf damage due to insect herbivores and the specific consequences of it remain unknown. However, researchers believe widespread change influenced by human activity, such as the rate of global warming, urbanization and the introduction of invasive plants and insects, could be driving the uptick. Human activity may have drastically changed how insect herbivores are interacting with their food source, the researchers say. 

The research team published their findings in Proceedings of the National Academy of Sciences of the United States of America. 

“Humans understand that climate is always changing and that the Earth has previously been hotter, but we often can’t grasp the ‘oddity’ of modern climate change,” Azevedo-Schmidt says. “The geologic record reported here should have supported comparable levels of insect herbivory, but it didn’t because humans weren’t present in our post-industrial revolution capacity. This shows the heartbreaking reality that humans have a much higher impact on forest ecosystems than increased atmospheric CO2 alone. However, we can work to minimize our impacts on forest ecosystems by considering the intersection of these findings.” 

The researchers also found that the damage caused by insects in leaf samples from recent history is slightly more diverse than that in fossilized leaves. The increase in leaf damage diversity, however, is not as drastic as the spike in damage frequency. 

Researchers examined total damage frequency and diversity along with various types of damage including specialized, piercing and sucking, surface feeding, hole feeding, galling, mining, skeletonization, margin feeding and specialized damage. In addition to discovering an overall uptick in total damage frequency, the team also found an increase across all groupings of damage. 

“Increased insect feeding can’t be explained by one group of insects but rather, all groups of feeding damage analyzed here,” Azevedo-Schmidt says. “This suggests that all insect herbivores within these three modern forests are increasing their feeding damage; complicating the story as we can’t simply blame one species or group.” 

No correlation was identified between damage diversity and frequency, according to researchers. The drivers behind the uptick in damage diversity are also unknown. 

“This is interesting because it suggests that insect diversity isn’t influencing insect feeding frequency and that other drivers are responsible for the drastic increase we are seeing,” Azevedo-Schmidt says. 

According to researchers, insects and plants possess the most diverse lineages on the planet, and how they interact has evolved over millennia in response to natural and unnatural causes. 

How plant-insect relationships change over time, including the extent to which the latter feeds on the former, has implications for biodiversity, plant functionality and mortality, and carbon balance in forests — the loss of plant life can decrease the ability for a forest to absorb atmospheric carbon dioxide through photosynthesis.

“This study is the first to compare similar records of plant-insect interactions across modern and fossil datasets,” Azevedo-Schmidt says. “These findings highlight the importance of humans interacting with landscapes and although climate change influences ecosystem processes, it is not the only factor we need to consider. Humans are agents of disturbance and dispersal, greatly influencing the natural world around us.” 

Contact: Marcus Wolf, 207.581.3721; marcus.wolf@maine.edu

Share this:

Read Full Post »

Older Posts »