Produced by the International Association for the Plant Protection Sciences (IAPPS). To join IAPPS and receive the Crop Protection journal online go to: www.plantprotection.org
AgriBusiness Global Direct – The Next Generation of Magazines Get reports that offer news, analysis, and insight about industry issues that matter. From macro trends to global agribusiness perspectives, you’ll find it all here. EXPERIENCE THE LATEST >
Syngenta and FMC to bring to market breakthrough technology to control rice weeds in Asia. Photo: Business Wire
Syngenta Crop Protection and FMC Corporation have announced an agreement to bring to market a breakthrough technology to control grass weeds in rice in Asia. The new active ingredient Tetflupyrolimet, discovered and developed by FMC with support from Syngenta for the development in rice, marks the first major herbicide with a novel mode of action (DHODH – HRAC Group 28) in over three decades, promising relief to farmers challenged by weed resistance to existing herbicides.
Tetflupyrolimet boosts the yield and quality of rice production by delivering season-long control of the most significant grass weeds, which compete with the crop for water, fertilizer, light and space, and host pests and diseases that impact rice farming. A further benefit of this technology is that it can be used at low rates with good crop safety. In addition to being easy to apply in traditional transplanted rice, the herbicide is also highly suited to direct-seeded rice, paving the way for the greater adoption of modern and more environmentally friendly cropping systems.
“This innovation will drive a step-change in the yield and quality of rice harvests, address the growing challenge of weed resistance, and could transform the lives of millions of rice farmers,” said Ioana Tudor, Global Head of Marketing at Syngenta Crop Protection. “At Syngenta, we are excited by the potential of this new technology to elevate the sustainability of global rice production.”
Rice production is central to the livelihoods of an estimated 150 million farmers globally, who supply a fifth of the world’s dietary energy. It is the most important food crop in developing countries, accounting for close to 30 percent of the total calorific intake of these populations. Rice farming is also one of the most important sources of employment in rural areas.
Under the agreement, Syngenta and FMC will both bring Tetflupyrolimet based products to key rice markets in Asia. Syngenta will register and commercialize Tetflupyrolimet in China – the world’s largest rice market. In addition, Syngenta will commercialize products containing mixtures of Tetflupyrolimet for rice in India, Vietnam, Indonesia, as well as in Japan and South Korea. FMC will register and commercialize Tetflupyrolimet and an array of products in all these countries, except in China where it will focus on mixtures for rice. Syngenta will further exclusively commercialize Tetflupyrolimet for rice in Bangladesh.
CABI collaborates with entomologist in Ghana to train vegetable farmers in the local preparation of neem seed-based biopesticides.
Professor Fening taking trainees through processes for preparing neem seed extracts
In collaboration with Professor Ken Owae Fening, an entomologist from the University of Ghana, PlantwisePlus has trained 44 vegetable farmers in the local preparation of neem-based biopesticides for pest control in vegetable production.
The training took place in March with 38 males and 6 female farmers engaged in vegetable production in the Anloga district of the Volta Region. It forms part of strategic objectives of the CABI PlantwisePlus programme to develop capacity and systems for, and also promote the increased production and use of, safer locally available and affordable low-risk plant protection products. Therefore, replacing the use of the highly hazardous chemicals for pest control in crop production.
Through this, the programme seeks to enhance knowledge and uptake of climate adaptive, environmentally-friendly and low-tech agricultural technologies. These can provide low-risk solutions for managing devastating crop pests.
Why use neem seed?
The initiative to use neem seed extracts for pest control comes on the back of research and trials done by the University of Ghana which proved that neem seed extract is effective for controlling the Diamond Back Moth (DBM) in cabbage. The research showed that the active ingredient in neem (Azadirachtin) is much more concentrated in the neem seeds. Therefore, training farmers to prepare and use extracts from the neem seeds can be an effective way of increasing access to safer and affordable homemade biopesticides. This will reduce overreliance on the more hazardous chemical pest control options.
Unlike the conventional pesticides, neem exhibits different modes of action. For example, serving as antifeedant or feed deterrent, repellent, growth arrestant, among others. This makes the extract effective for controlling a range of pest infestations in the field.
Preparing the neem seed extract
The training focused on equipping the farmers with the specific skills required to undertake each step of the preparation process. This included harvesting/collection and de-pulping of mature fruits to obtain seeds. And appropriate methods of drying and storing them.
The farmers also learned about the manual pounding of dried neem seeds to obtain a fine paste, from which the extract is finally obtained. The extract is mixed with water and strained to obtain the solution used for in spraying fields.
Harvested mature Neem fruits
Increasing the uptake of lower-risk plant protection products
It is expected that the training will stimulate the interest of farmers in adopting proven low-cost, low-tech, locally available and safer pest control products. This will in turn help to reduce the health, environmental and food safety hazards associated with the overuse of chemical pesticides.
The farmers are likely to actively share the knowledge they acquired from the training with other farmers in their network. Thereby, helping to reach more farmers with the technology.
A post-training follow-up has shown that some of the trained farmers have already started harvesting matured neem fruits which are currently in season. They have de-pulped the fruit to obtain the seeds for storage. These seeds will later be processed and used in the new cropping season.
Going forward, the PlantwisePlus programme aims to develop a training manual on the collection, preparation and application of neem seed extract to support further trainings in other districts and regions.
About CABI PlantwisePlus
The CABI-led worldwide programme – PlantwisePlus – seeks to help smallholder farmers produce more and high-quality food. Over a period of ten years (2020 – 2030), the programme will help the ministries of agriculture and other relevant state agencies of focus countries to predict, prepare and prevent a range of plant health issues which put food security and livelihoods at risk.
PlantwisePlus aims to accelerate the availability and use of nature-positive and low-risk plant protection products to reduce reliance on high-risk farm inputs and contribute to consumer demand for safer, higher quality and locally produced food.
The programme is also working to provide digital advisory tools to boost sustainable agriculture and improve the capacity of public and private actors offering support to smallholder farmers to diagnose crop health problems – and recommend sustainable management practices.”
The battle against viral diseases: Novel strategies for antiviral resistance in potatoes
on May 17, 2023
This article was written by Jorge Luis Alonso G., an information consultant specializing in the potato crop.
Scientists at the Inner Mongolia Agricultural University in China recently published a review in the journal Plants describing the advancement of antiviral strategies in potatoes through the engineering of both viral and plant-derived genes.
The article below is a summary of the information presented in this scientific paper.
1. Introduction
Potatoes, as a nutritious and staple food crop, have the potential to address food insecurity in developing countries. However, a major impediment to this aptitude is the prevalence of viral diseases in potato production, which result in the destruction of seed potatoes and often cause yield losses of 20–30%. Major viruses, including Potato virus Y (PVY), Potato leafroll virus (PLRV), and Potato virus X (PVX), cause various damaging symptoms such as leaf curling, necrosis, and stunted growth.
Complicating disease prevention, these viruses enter the plant through various vectors and use plant resources to replicate. Although virus-free seed potato technology can limit disease damage, some viruses are persistent and can re-infect during the growing season.
In addition, the hetero-tetraploid nature of the plant limits conventional breeding methods in developing antiviral potato varieties. On the positive side, advances in molecular biology and plant genetic engineering have opened the door to creating virus-resistant crops. Promising strategies have emerged, such as RNA interference (RNAi)-mediated resistance, which targets the viral coat proteins of the major potato viruses.
Eventually, genetically modified (GM) potatoes, including virus-resistant varieties, are now being introduced and commercialized in certain countries. This progress represents a major step forward in the fight against potato virus diseases.
2. Engineering Virus-Derived Viral Resistance in Potato
Researchers have developed genetically engineered virus-resistant plants, including potatoes, by using the coat protein (CP) gene of viruses such as tobacco mosaic virus (TMV), PVY, PVX, and PLRV. CP has several functions, including protection of the viral nucleic acid and regulation of the host range of infection. However, CP-mediated resistance is often limited, providing protection only against the CP donor virus or related strains and only at low viral doses. Additional complications in virus transmission can arise when the plant is transformed with the CP of an insect-borne virus.
To overcome these challenges, investigators are attempting to combine different viral CPs in the same plant or to incorporate coat protein genes with satellite RNA for a broader antiviral spectrum. An alternative approach involves replicase, an RNA polymerase encoded by viral genes. This enzyme synthesizes the positive and negative strands of viral RNA during replication. Although researchers have shown that replicase-mediated resistance is stronger than CP-mediated resistance, its specificity limits its use in the field due to the rapid mutation rate of plant RNA viruses.
In addition, antisense RNAs (asRNAs), which are complementary to messenger RNA (mRNA), have also been used for viral resistance. Although some success has been achieved in acquiring antiviral infection ability and protecting plants, antisense RNA-directed resistance is generally weak due to insufficient expression, which limits its practical application. However, there are still ways to improve the expression level of antisense RNA, which keeps this avenue open for exploration.
3. Engineering Virus-Resistant Plants Using Plant Endogenous Genes in Potato
Scientists are increasingly focusing on creating virus-resistant plants by using the plant’s own genes. They have discovered antiviral genes in both wild and cultivated potato species. These can be categorized into two distinct groups: extreme resistance (ER) genes and hypersensitive resistance (HR) genes. ER genes are known to resist many viruses and thwart viral reproduction in the early stages of infection. On the other hand, HR genes resist various virus species, triggering cell necrosis after a virus infection to limit its spread.
In potatoes, the Ry genes confer ER to all PVY strains, including the Rysto, Ryadg, and Rychc genes. Breeders have incorporated these into potato breeding programs and have identified Rysto as recognizing the central 149 amino acids of the PVY coat protein domain, suggesting its potential utility in engineering virus resistance.
The Y-1 gene is unique in its action as it induces cell death without preventing the systemic spread of PVY, thus hinting at its possible use in potato breeding. The G-Ry gene, a Y-1 homolog, has been detected to enhance resistance to PVY. Meanwhile, Ny genes, such as Ny-1 and Ny-2, have demonstrated HR against PVY in many potato cultivars. The Nytbr gene exhibits hypersensitivity to PVY, showing necrosis symptoms upon infection. Interestingly, scientists have identified the HCPro cistron of PVY as influencing necrotic reactions and resistance in plants carrying certain resistance genes.
As for resistance to PVX, it is mediated by the Rx1 gene, which causes a rapid termination of viral replication. A transcription factor that interacts with Rx1 mediates antiviral immunity, thereby enabling the Rx1 gene to confer ER to PVX.
One major and two minor quantitative trait loci (QTL) for resistance to potato leaf roll virus (PLRV), a potato disease, have been identified. The major QTL has mapped to potato chromosome XI. These identified genes associated with potato virus resistance can be used for antiviral breeding and for the development of potato varieties resistant to a single virus or many viruses. However, further research is needed to use these resistance genes and to discover new ones.
4. RNAi-Mediated Viral Resistance in Potato
RNA silencing, a common gene regulation mechanism in eukaryotes, plays a central role in protecting against viruses. This mechanism involves the interaction of small interfering RNAs (siRNAs), Dicer-like (DCL) endonucleases, and AGO family proteins. Specifically, DCL4 and DCL2 are responsible for generating siRNAs that mount a defense against RNA viruses. Further amplifying this system, RNA-dependent RNA polymerases (RDRs) convert aberrant single-stranded RNA into double-stranded RNA precursors of secondary siRNAs. This strategy is particularly promising for the development of virus-resistant transgenic plants.
In the specific context of viroid infection in plants, RNA silencing plays an important role. For example, replication of potato spindle tuber viroid in tomato plants induces resistance to RNA silencing, suggesting the critical role of secondary structures in resistance to RNAi.
The process of RNAi silencing can be manipulated to change miRNA sequences, creating artificial miRNAs (amiRNAs) that can target specific sequences. This ingenious approach has been used to engineer virus-resistant plants by creating resistant plants by creating amiRNAs that can actively fight viral infections.
In nature, however, viruses often encode silencing suppressors to counteract host RNAi-based defenses. To improve viral resistance, research is focused on enhancing RNAi activity by increasing the efficiency of AGO proteins and modifying siRNAs.
Despite extensive studies on RNA silencing as a strategy in plant antiviral protection, the beneficial effect of RNA silencing in viral infection remains somewhat puzzling. In particular, the mechanism by which some components of RNA silencing systems contribute to viral infection is not well understood. A deeper understanding of this could open up new opportunities for engineering viral resistance in various crops, such as potato.
5. CRISPR/Cas9-Mediated Viral Resistance in Potato
CRISPR/Cas, a system created to provide immune protection against invading nucleic acids in bacteria, has been repurposed for efficient genome engineering and the development of antiviral immunity in plants. This was amply demonstrated by the ability of CRISPR/Cas systems to effectively control Beet Severe Curly Top Virus (BSCTV) in N. benthamiana and A. thaliana. In addition, the CRISPR/Cas9 system has been ingeniously used to mutate susceptibility genes in rice and tobacco to confer resistance to Rice Tungro Spherical Virus (RTSV) and Potato Virus Y (PVY), respectively.
Besides these applications, the CRISPR/LshCas13a system was used in potato crops to generate resistance to Potato Virus Y, further demonstrating the potential of CRISPR technology in crop protection. Taken together, these studies underscore the significant capacity of CRISPR/Cas9 to control plant RNA viruses in major crops such as potato.
6. Future Prospects and Conclusions
As the battle against genetically complex virus strains in potato varieties escalates, researchers are moving to strengthen virus resistance. They are gearing up for a multi-pronged strategy.
First and foremost, they aim to disrupt the virus-host interaction by editing the potato genome. Using the available potato genome sequences, their goal is to construct an effective shield to protect potato plants from viral invasion. In this regard, they’ve identified CRISPR editing technology as a possible powerhouse in the fight against plant virus infections, a tool that could outperform RNAi.
Second, they are embarking on a mission to discover resistance genes that are key to antiviral response. This discovery could provide a significant boost to potato breeding efforts. Once identified, these genes will be introduced into potato plants through genetic transformation.
Third, they are formulating plans to harness the power of inducible responses in naturally virus-resistant plants. Because these plant defenses have broad-spectrum capabilities, their goal is to identify viral components that activate plant immune mechanisms. This promising area of study could reveal resistance genes that control these protective mechanisms. This, in turn, would pave the way for the development of strategies to engineer the broad-spectrum components of natural defenses.
Fourth, armed with an increasing understanding of the molecular functions of viral proteins, they plan to manipulate these proteins to create cross-protection against further viral infection in potato plants.
Finally, they see the transgenic expression of antiviral proteins of non-plant origin, including antibodies, as a promising frontier in the search for increased resistance to specific potato viruses. This approach underscores the relentless pursuit of new strategies to strengthen potatoes against viral threats.
Source: Liu, J., Yue, J., Wang, H., Xie, L., Zhao, Y., Zhao, M., & Zhou, H. (2023). Strategies for Engineering Virus Resistance in Potato. Plants, 12(9), 1736.https://doi.org/10.3390/plants12091736 Photo: Potato leafroll virus causes stunted plants. Credit Government of Western Australia
Share this news story with colleagues on social media or email:
Understanding how the ‘heart’ of the plant works may lead to protection from pathogens
Phys.Org
by Aarhus University Plants, like humans, need to move sugar and other nutrients around their bodies to power their growth. But unlike humans, they do not have a heart to pump these vital nutrients. Instead, they use an amazing molecular pump mechanism that scientists have been studying for decades since its discovery more than 30 years ago.
Now, a team of researchers led by Associate Professor Bjørn P. Pedersen at the Department of Molecular Biology and Genetics at Aarhus University has made a groundbreaking discovery about the SUC transporter, one of the most important components of this pump mechanism. This molecule is like a microscopic sugar delivery truck that actively loads a type of sugar called sucrose (tabletop sugar) into the plant’s “veins,” which are called the phloem.
Until now, scientists have struggled to understand exactly how this transporter works. But the team’s new research has uncovered the secrets behind how the SUC transporter recognizes sucrose and how it uses acid to power its sugar delivery. The results have been published in Nature Plants.
The Egyptian cotton leafworm (Spadoptera littoralis) – a moth species found throughout the Mediterranean Basin, as well as in Africa and the Middle East – is currently a widespread pest in France. Since moth larvae are highly polyphagous, feeding upon a variety of different species, they cause damage to a diversity of crops, including corn, cotton, peppers, legumes, and tomatoes.
As part of increased efforts to reduce pesticide levels, scientists currently struggle to develop effective biocontrol methods to fight crop pests, such as strategies to disrupt their reproduction or trap them through the use of sex pheromones. However, since pheromone synthesis is expensive, other control strategies may be needed. A team of scientists led by the Sorbonne University in Paris has recently investigated the evolution of olfactory receptors in the Egyptian cotton leaf worms. The research, published in the journal Proceedings of the National Academy of Sciences, represents an important step forward toward the development of such strategies
Left: Gloomy scales (Melanaspis tenebricosa) can be dense on urban red maple trees. One scale in the center of the image has its outer cover removed. Right: Scales attract predators such as this minute lady beetle (Microweisea sp.) by directly acting as prey or by attracting other prey species that feed on scale honeydew. (Photos by Matt Bertone, Ph.D., NC State University)
By Caleb Wilson, Ph.D.
Caleb Wilson, Ph.D.
Last year, I shared findings from my research on infestations of scale insects in urban trees. Because scales are eaten by many arthropod predators and used as hosts by many parasitoid wasp species (collectively referred to as “natural enemies”), we studied the natural enemy communities found within urban trees infested with scales relative to uninfested trees. In short, our findings, published in October 2022 in Environmental Entomology, suggest that tolerating scales on urban trees can conserve natural enemies both within trees and in shrubs below them. By supporting large natural enemy communities in plants below them, scale-infested trees may also prevent pest outbreaks on plants growing near them.
Since completing that original study, my advisor Steven Frank, Ph.D., at North Carolina State University and I conducted two follow-up studies within this system to better understand 1) what kinds of predators are supported by scale-infested trees and 2) do scale-infested trees support natural prey removal (also known as “biological control”) in shrubs growing below them?
To answer the first question, we examined the community of spiders that we found in scale-infested and uninfested tree canopies and in holly shrubs below these trees. Spiders were the most abundant natural enemy group we collected in trees and shrubs, and spiders are an ecologically diverse group of predators that use a variety of strategies to capture and kill their prey. Because spiders are important predators of many landscape pests, identifying environmental factors that conserve spiders, such as pest densities in trees, will inform sustainable pest management practices in urban landscapes.
Spiders are often separated into different “guilds” based on their different prey-capture strategies. For example, orb-web weaving spiders create distinct orb-shaped webs that are often oriented vertically to capture prey. In comparison, sheet-web weaving spiders create small, flat webs that are oriented horizontally, while active hunting spiders do not create webs at all but rather chase and capture their prey.
Left: Sheet-web weaving spiders create small horizontal webs that the spider typically hangs below. In certain shrubs such as yaupon holly (Ilex vomitoria), these webs can be abundant at certain times of the year. (Photo by Caleb Wilson, Ph.D.) Right: Hunting siders such as this green lynx spider (Peucetia sp.) chase and capture their prey. (Photo by Matt Bertone, Ph.D., NC State University)
Knowing which spider guilds are abundant in scale-infested trees will indicate which spiders benefit from the recruiting of natural enemies associated with scale insects. This is important because researchers have documented that certain spider families or guilds are often rarer in cities compared to rural areas. If scale-infested urban trees support these otherwise uncommon spider guilds, scale-infested trees may be important for conserving spiders that would otherwise be sensitive to urban development.
So, what did we find? We found that scale-infested trees hosted more orb-web weaving spiders relative to uninfested trees, while holly shrubs under infested trees hosted significantly more orb-web weavers, space-web weavers, and active hunting spiders relative to shrubs under scale-uninfested trees.
Top left: A common orb-web weaving spider species is the yellow garden spider (Agriope aurantia). (Photo by Caleb Wilson, Ph.D.) Top right: Space-web weaving spiders such as the common house spider (Parasteatoda tepidariorum) create irregular cobwebs. (Photo by Matt Bertone, Ph.D., NC State University) Bottom: Active hunting spiders such as this Wulfila sp. spider do not create webs; ghost spiders (family Anyphaneidae) are common representatives of this guild. (Photo by Matt Bertone, Ph.D., NC State University)
Our results suggest that tolerating scales on urban trees can help conserve orb-web weaving, space-web weaving, and hunting spiders over other guilds. More broadly, our results indicate that scales, and likely other tree pests as well, have understudied potential for spider conservation in cities.
Our second follow-up study assessed if insect prey were more likely to be removed from holly shrubs underneath scale-infested trees relative to shrubs under uninfested trees. The prey we used for these experiments were crapemyrtle aphids (Tinocallis kahawaluokalani), dead Drosophila adults (a mixture of D. suzukii and D. melanogaster), and caterpillars (Helicoverpa zea and Spodoptera frugiperda). On large, planted holly shrubs underneath infested and uninfested trees we recorded removal of all three prey types. These shrubs comprised two different species: Ilex vomitoria, a native species, and I. cornuta, an exotic holly species.
Left: A crape myrtle leaf is infested with crapemyrtle aphids (Tinocallis kahawaluokalani). Middle: A sac spider (family Clubionidae) feeds on a corn earworm caterpillar (Helicoverpa zea) on a Chinese holly (Ilex cornuta). Right: A notecard with 10 Drosophila spp. adults is attached to a yaupon holly (Ilex vomitoria) shrub. (Photos by Caleb Wilson, Ph.D.)
We ran similar experiments that measured the removal of Drosophila and caterpillar prey on potted holly shrubs underneath both tree types. We ran prey-removal experiments on planted and potted hollies so that we could compare our results in shrubs that ground-dwelling predators were able to access (planted hollies) and in potted hollies that ground-dwelling predators could not access. To keep ground-dwelling predators out of potted hollies, we coated the outside of pots with Fluon and we treated the soil in these pots with permethrin.
Left: A lady beetle larva (Harmonia axyridis) feeds on Drosophila spp. adults. Right: A lacewing larva (family Chrysopidae) feeds on Drosophila spp. adults. For experiments, we placed Drosophila spp. adults on notecards and recorded their removal after one day. We added sand to these cards to provide traction to predators. (Photos by Caleb Wilson, Ph.D.)
Yaupon hollies (Ilex vomitoria) growing below scale-infested willow oaks (Quercus phellos) receive associational pest resistance due to the movement of natural enemies from tree canopies to shrubs below them. (Photo by Caleb Wilson, Ph.D.)
In this case, we found that Drosophila adults in planted hollies and caterpillars in potted hollies were more likely to be removed underneath infested trees relative to uninfested trees. In all other experiments we found no effect of tree type on prey removal. We also found that caterpillars were more likely to be removed from native Ilex vomitoria shrubs relative to exotic I. corntua shrubs.
In addition to supporting natural enemies in plants below them, scale-infested trees can also support natural pest regulation in shrubs below them. However, this effect can be influenced by the type of insect prey present within shrubs, as well as what species of shrub is present.
What should we take away from these studies? First, scale-infested trees have the potential to conserve natural enemies both within their canopies and in shrubs below them. Second, scales and the diverse arthropod communities found in close association with them, conserve orb-web weaving, space-web weaving, and active hunting spiders. Third, by conserving natural enemies, scale-infested trees also support biological control of pests in plants below them.
Scale insects appear to have understudied conservation potential for natural enemies in urban landscapes, and these conservation benefits also have the potential to prevent pest issues in nearby plants. Although scales are often considered pests in urban trees, our work indicates that scales are important for conserving natural enemies and their biological control services.
Caleb Wilson, Ph.D., is a postdoctoral research associate in the Department of Entomology at Michigan State University and a recent doctoral graduate from North Carolina State University. Email: wils1852@msu.edu.
The entomopathogenic fungus (EPF), Beauveria bassiana, is reported as the most potent biological control agent against a wide range of insect families. This study aimed to isolate and characterize the native B. bassiana from various soil habitats in Bangladesh and to evaluate the bio-efficacy of these isolates against an important vegetable insect pest, Spodoptera litura. Seven isolates from Bangladeshi soils were characterized as B. bassiana using genomic analysis. Among the isolates, TGS2.3 showed the highest mortality rate (82%) against the 2nd instar larvae of S. litura at 7 days after treatment (DAT). This isolate was further bioassayed against different stages of S. litura and found that TGS2.3 induced 81, 57, 94, 84, 75, 65, and 57% overall mortality at egg, neonatal 1st, 2nd, 3rd, 4th, and 5th instar larvae, respectively, over 7 DAT. Interestingly, treatment with B. bassiana isolate TGS2.3 resulted in pupal and adult deformities as well as decreased adult emergence of S. litura. Taken together, our results suggest that a native isolate of B. bassiana TGS2.3 is a potential biocontrol agent against the destructive insect pest S. litura. However, further studies are needed to evaluate the bio-efficacy of this promising native isolate in planta and field conditions.
Introduction
The reduction of crop losses due to insects is becoming a bigger challenge for the world’s food production. Due to concerns about their impact on human health, the environment, and the food chain, many of the older, less expensive chemical insecticides are no longer being registered1. New technologies like expensive, more selective chemicals and genetic modification are being used, but this increased selection pressure accelerates the evolution of resistance in insect pests. Global agriculture urgently needs more environmentally friendly pest management techniques.
The tobacco caterpillar, Spodoptera litura (Fabricius) (Lepidoptera: Noctuidae), is one of the most devastating pests of 120 crop plants, including cauliflower, groundnuts, cotton, onions, tomatoes, brinjal, turnips, and cabbage2. Each year, it goes through five to six overlapping generations, and if it is not promptly treated, it might cause significant crop losses up to complete destruction3. Insecticides are the most often used method for controlling this problem. Although this is effective in reducing pest populations in the short term, long-term exposure to insecticides may cause S. litura to develop the 3 R’s issues, viz., resistance, resurgence of insects, and residues on crops, like other Noctuidae members4. In addition, the use of pesticides leads to ecological imbalances by destroying non-target organisms and their natural enemies, parasites, and predators. The public’s growing concern over the potential ecological and health risks of synthetic pesticides has shifted the focus of research toward more environmentally benign methods for controlling insect pests5.
Insect-pathogenic or entomopathogenic fungi (EFP) (Fungi: Ascomycota, Order: Hypocreales) cause disease in insects. These entomopathogens are used as biocontrol agents, or “biopesticides,” for the management of insect pests6. They provide an alternative to chemical insecticides for protecting crops7 and reducing the harmful environmental impacts of chemical insecticides8. An increasing number of products based on EPF are being registered as insecticides and used in developed and developing countries like the United States of America, the United Kingdom, Australia, Canada, China, India, etc.8.
Among the members of the genus Hypocreales, Lecanicillium sp., Beauveria sp., and Metarhizium sp. have been effectively used to control aphids, lepidopteron larvae, and other pests9. Among them, Beauveria bassiana (Balsamo) Vuillemin is responsible for causing white muscardine disease in a variety of insects. Beauveria infects the insect by degrading the host cuticle using mechanical and chemical forces, which are particularly advantageous in pest control because direct ingestion of fungal propagules is not needed by insects, thus also becoming active against the non-feeding stages of insects10. In addition, among the cyclic hexadepsipeptide mycotoxins produced by the different EPF, beauvericin, produced by B. bassiana, has shown the most effective larvicidal properties11.
Like other Hypocreales, the species of Beauveria show pleomorphic life stages. They are often described as cryptic fungi, i.e., morphological characteristics are changed in response to the environment, and thus morphological description fails to clarify their systematics at species level12. Nowadays, researchers are using polymerase chain reaction (PCR) based molecular techniques to reconstruct the Beauveria phylogeny for accurate identification of Beauveria species. Among the molecular markers, the internal transcribed spacer (ITS) region of rDNA is considered a universal bar code for fungus identification13. But in case of Hypocreales, ITS analysis produced low resolution in many cases and failed to resolve the phylogeny of Beauveria14. Additional genomic markers like translation elongation factor-1α (TEF) are needed for the species-level determination of Beauveria to be made correctly14.
Although B. bassiana showed a broad spectrum of pathogenicity against a wide range of insects, its bio-efficacy depends on the isolation source and life stages of the target stages. Insecticide resistance and resurgence issues can be effectively addressed by controlling insect pests with local isolates of fungus15. These native isolates also have higher survival and persistence abilities under local environmental conditions16. In conservation agriculture guidelines, it is also important to isolate potential native bioagents to prevent contamination from imported biopesticides. In addition, the pathogenicity of the biocontrol agent differs according to the different life stages of the target insect17. Identification of the more suspectable stage of insects against fungal inoculum increases the bio-efficacy of biological control strategies in field conditions. Therefore, the present investigation was carried out to isolate and molecularly characterize native Beauveria isolates and test their bio-efficacy against different life stages of S. litura.
Results
Isolates of Beauveria
Among the isolated fungal isolates on selective medium, seven isolates showed characteristics of the morphology of Beuaveria species. The single fungal colonies of the isolates were white in color, round, lightly elevated with a powdery appearance, and lightly downy with circular rings. Conidia were hyaline and round. Single cell conidiophores were short, densely clustered, and hyaline (Fig. 1).
Figure 1
Molecular identification and phylogeny of Beauveria isolates
The partial sequence datasets of ITS and TEF were processed and analyzed individually through Geneious V.11 software, and accession numbers were obtained from NCBI (Table 1). The genomic ITS and TEF data of seven isolated Beauveria isolates showed BLAST similarity, with many references to B. bassiana in BLAST search results in the NCBI database. The reconstructed maximum likelihood phylogenetic tree of the ITS data set showed that the seven morphologically characteristic isolates were clustered with the reference B. bassiana isolate with a moderate bootstrap support value (60%) (Fig. 2). Furthermore, a tree constructed with the TEF data set showed the maximum support (100%) for the clade containing isolated Beauveria isolates and references to B. bassiana (Fig. 3). Thus, both the ITS and TEF data sets confirmed the isolated strains as B. bassiana.Table 1 NCBI accession numbers of isolated B. bassiana isolates.
Overall mean mycelial growth revealed that the fungal isolate TGS2.3 (388.27 ± 10.29 mg/100 mL) exhibited the highest biomass production, and the lowest growth was observed in TGS1.2 (208.8 ± 8.03 mg/100 mL) (Fig. 4).
Figure 4
Insect bioassay
Seven days following infection of the 2nd larval instar by seven B. bassiana isolates revealed that TGS2.3 had the highest mortality rates (81.72 ± 2.15%) followed by TGS2.1 (72.40 ± 3.46%), BeauD1 (61.29 ± 1.08%), BeauA1 (51.61 ± 2.15%), KSS1.1 (49.46 ± 4.69%), TGS1.2 (46.59 ± 2.71%), and KSS2.2 (43.73 ± 3.78%) (Fig. 5).
Figure 5
The findings implied that the death of 2nd instar larvae of S. litura treated with TGS2.3 and TGS2.1 occurred mostly during the first two days of infection, especially on the first day for TGS2.3. The mortality was caused more gradually from day-one to day-seven by the other Beauveria isolates, viz. BeauA1, BeauD1, KSS1.1, KSS1.2, KSS2.2, and TGS1.2 (Fig. 6).
Figure 6
As the first day was when the most deaths occurred, results were statistically analyzed to ascertain which isolates induced the highest day-one mortality (causing high mortality within 24 h of infection). Samples infected with TGS2.3 (56.67 ± 7.02%) had the highest day-one mortality, followed by TGS2.1 (43.33 ± 3.51%) (Fig. 7).
Figure 7
Hatchability and neonate larval mortality after TGS2.3 treatment
Egg hatchability was drastically reduced in the TGS2.3-treated eggs compared to the control. The isolate TGS2.3 induced 81.25 ± 2.75% egg mortality, whereas in control it was 18.5 ± 2.65% (Fig. 8). The 7-days post treatment data also revealed that TGS2.3 induced 57.25 ± 6.34% neonatal larval mortality, whereas in control it was 8.25 ± 2.63% (Fig. 9).
Figure 8Figure 9
Bioassay against different larval stages of S. litura by B. bassiana isolate TGS2.3
The larvae treated with the TGS2.3 isolate succumbed to fungal infection and showed different mortality rates in various larval stages. The highest mortality was recorded in 1st instar larvae (94.45 ± 4.60%) and the lowest was in 5th instar larvae (56.56 ± 2.07%). The mortality rates in 3rd and 4th instar larvae were statistically similar (Fig. 10).
Figure 10
Cumulative mortality over 7 days demonstrates that 1st instar larvae had the highest day-one mortality, which progressively rose until the 4th day. The death of 2nd instar larvae began on day-one and subsequently increased until day-five. The 3rd instar larvae did not die until the 3rd day, and the death rate progressed until the 6th day. The death of larvae in the 4th and 5th instars occurred on the 4th day and subsequently increased until the 7th day (Fig. 11). Overall, the mortality across various time points revealed all larval instars of S. litura to be susceptible to the fungus TGS2.3.
Figure 11
Mycosis and sub-lethal effects
The mobility of the infected larvae was reduced. The larvae were stiff and rigid after dying. Within two days of death, the deceased larvae began to produce mycelium. (Fig. 12). The B. bassiana infection was verified by the slides prepared from this fungus’ growth. When compared to control larvae, B. bassiana negatively impacted the emergence of adults from the 2nd, 3rd, 4th, and 5th instars. A smaller number of adults (7.11–37.94%) emerged from fungus treated larvae than from control larvae (94%) (Fig. 13).
Figure 12Figure 13
Deformities
The fungal infection caused a wide range of abnormalities. When some of the treated larvae molted into pupae, they did not entirely detach from the exuvium (Fig. 14). Some pupae lacked a completely developed cuticle. When 2nd instar larvae were treated with B. bassiana, they had 9.33 ± 2.08 percent pupal deformities. Similarly, the pupal deformity was 7.67 ± 1.53, 10 ± 2 and 6.67 ± 1.53 percent owing to the treatment of 3rd, 4th, and 5th instar larvae, respectively (Fig. 15). Adults developed from fungus infected larvae had 3.67–10% deformities (Fig. 16) with folded, undeveloped wings (Fig. 17). The control group, however, showed no deformation.
Figure 14Figure 15Figure 16Figure 17
Discussion
The tobacco caterpillar (S. litura) is one of the most devastating pests of various crops. Insecticides are the most commonly used method for controlling this problem. The use of pesticides leads to ecological imbalances by destroying non-target organisms and their natural enemies, parasites, and predators. The public’s growing concern over the potential ecological and health risks of synthetic pesticides has shifted the focus of research toward more environmentally benign methods. Among them, B. bassiana causes white muscardine disease in a wide range of insects. Insecticide resistance and resurgence issues can be effectively addressed by controlling insect pests with local isolates of fungus and targeting more suspectable stages of insects.
In this study, seven B. bassiana isolates were isolated from soil samples and reported for the first time in Bangladesh as local isolates. The morphology described by previous studies5,18.was similar to that of our seven isolates. The ITS phylogeny produced a moderate support value for these seven isolates, which confirmed the inadequacy of the ITS analysis that had been previously reported1,14,19. However, ITS could be used for quick screening of a wide range of field isolates because of its PCR amplification efficiency20,21,22 and the availability of reference data23. Further molecular analysis with TEF data supported the phylogenetic position of seven isolates in the B. bassiana clade very strongly and proved its efficiency in resolving phylogenies for Hypocreales fungi1,14,19.
To find the best insect pathogenic B. bassiana isolate, the overall and daily mortality of 2nd instar larvae was investigated to determine the mortality induced by each fungal isolate. The highest mortality rate was induced by B. bassiana isolate TGS2.3 and could be because of higher insect pathogenic properties like conidial adhesion, germination rate, growth condition, or the production of enzymes or secondary metabolites. The very first stage of fungal infection is conidial attachment, and the strength of conidial attachment is a crucial indicator of the virulence of an entomopathogenic fungus. Fungal cell attachment to the cuticle may involve specific receptor-ligand and/or nonspecific hydrophobic and electrostatic mechanisms24,25,26. If the adhesion strength of EPF is weakened, then it could result in the washing off of the conidia from the host, thus preventing the infection27. The fluctuation of virulence among different isolates of B. bassiana may be due to their different levels of hydrophobic nature or their biochemistry.
Secondary metabolite synthesis might let EPF get past the immunological defenses of the insects and hasten mycosis6. According to some research, EPF B. bassiana creates host-specific secondary metabolites that, at low quantities, may result in 50% mortality11,28. The strain TGS2.3, which showed the highest insect mortality rate, may produce biologically active compounds with insecticidal activity against S. liturta. Further investigation is required to determine the bioactive compounds produced by B. bassiana isolate TGS2.3. The investigation and production of these compounds may open up new arrays of possibilities for controlling invasive crop pests.
The parameters, such as conidial germination and the production of hydrolytic enzymes are associated with the virulence of EPF21,29,30,31. A faster germination rate was found to exhibit higher virulence in B. bassiana29. The day-one mortality of TGS2.3 was the highest among all the isolates, which suggested that TGS2.3 has a higher germination rate. Hydrolytic enzymes such as protease, chitinase, and lipase are secreted by EPF to degrade the cuticle of host species to infect them32. Higher enzyme activity may be one of the reasons for the higher virulence of TGS2.3. Further investigation is needed to verify these hypotheses for our high-performing Beauveria candidate, TGS2.3.
The immobility of eggs is the main reason for insect vulnerability to microbial infections33. The nutrient requirement of an egg to develop into a hatchling is excessive, and they are highly targeted by pathogenic microbes at this stage34. This study showed that the eggs of S. litura were highly susceptible to TGS2.3. Similar results were found in previous studies where B. bassiana induced egg mortality in S. frugiperda35,36 and Phthorimaea operculella37. The isolate TGS2.3 also induced mortality in neonate larvae, which is similar to another study conducted by Idrees et al.17.
The mortality of larvae was highest in the 1st instar, and it gradually decreased with the advancement of each stage. The 1st instar larvae experienced 38% higher mortality than the 5th instar larvae. This indicates the decreased susceptibility of larvae with age. Shweta and Simon38 used B. bassiana against S. litura Fab. (Tobacco Caterpillar) in which the 1st and 2nd instar larvae showed higher mortality than the later stages. These variations in mortality between various instars might be attributed to enzymatic activity. According to different studies, detoxification enzyme activity changes significantly across and within developmental stages. The activity is modest in the egg stage, rises with each larval or nymphal instar, and ultimately decreases to zero during pupation39,40.
The EPF isolate TGS2.3 demonstrated sub-lethality over the life stages of S. litura. Pupal and adult deformities were produced as a consequence of the fungal infection in the larval stage. The larvae were unable to adequately transition into pupae. Insect molting has reportedly been hampered by B. bassiana41. Since the development of new cuticles during the molting process heavily depends on nutrients, any stage in the process might be affected if there is a nutritional imbalance in the hemolymph caused by a fungal infection. This sub-lethality of B. bassiana isolate TGS2.3 suggests a relatively prolonged sub-lethal influence of the fungi on S.litura, which may reduce S.litura populations more effectively in addition to direct mortality.
In summary, this study found that, the most potent isolate, TGS2.3, was effective against egg hatching and all stages of S. litura caterpillars and suggested that this fungal isolate could be utilized to target both the hatching and feeding stages of this target insect. Alongside, early stages of larval development of S. litura were more susceptible to fungal infection. The sub-lethal effects also demonstrated that once exposed to an entomopathogen, B. bassiana isolate TGS2.3 has the capability to kill insects at any descendant life stage of insect and reduce adult emergence. This study warrants further in planta evaluation in both laboratory and field conditions to evaluate the bio-efficacy of native B. bassiana isolates precisely. However, the findings of this research provided the potential for developing alternative S. litura pest control techniques as well as for limiting the use of synthetic pesticides, thereby minimizing their detrimental effects on the ecosystem.
Methods
Collection of soil samples
Soil samples were obtained from the Bhawal Sal Forest and agricultural fields in Gazipur, Bangladesh. To construct the composite sample, five different soil samples weighing a total of 250–300 g were mixed from a depth of 10–15 cm using a soil sampler. Until they were all studied, the soil samples were kept in distinct zip-lock bags with labels and maintained at 4 °C in a cold room.
Isolation of fungus
A soil suspension containing five grams of soil and 50 mL of 0.1% Tween 80 was made in a screw-cap plastic tube and incubated at room temperature for 3 h after being sieved through a 5 mm screen. Five inversions of each tube were performed at intervals of 30 min. The tubes were retained for 20 s after incubation to allow for sedimentation, and 100 µL of supernatant from each tube was plated on a Petri plate with Sabouraud dextrose agar (SDA) medium (peptone 10 g/L, agar 10 g/L, dextrose 40 g/L, and CTAB 60 mg/L). To avoid bacterial contamination, streptomycin (30 mg/L) was also added. Following inoculation, all plates underwent a two-week incubation period at 22 °C. Every 2–3 days, plates were checked for recognizable, thick, compact white mycelium development. Hypocreales-like isolates were isolated and sub-cultured.
Morphological study
Both the vegetative and reproductive structures of fungal colonies on SDA were examined using microscopy immediately after sporulation. From the outermost part of the fungal colony, little plaques were transferred to glass slides and inspected under a compound light microscope.
Sub-culture, DNA isolation, and molecular characterization
On SDA agar plates without antibiotics, the fungal isolates were sub-cultured for DNA isolation and sequencing. The procedure described by Islam1 was used to extract the DNA.
Briefly, a little lump of fungal mycelium from a 7-day-old culture was placed in an Eppendorf tube, mashed with a sterile plastic pestle, and then suspended in 1 mL of lysis buffer (400 mM Tris–HCl, pH 8.0, 60 mM EDTA, 150 mM NaCl, and 1% SDS), which was then incubated at 50 °C for 1 h in a heat block. A volume of 150 μL of precipitation buffer (5 M potassium acetate, 60.0 mL; glacial acetic acid, 11.5 mL; distilled water, 28.5 mL) was added in the tube and vortexed shortly, then incubated on ice for 5 min. The supernatant from the centrifugation was transferred to a fresh tube along with 500 mL of isopropanol to precipitate the DNA. After centrifugation at 18,000 rcf for 20 min, the DNA pellet was recovered and washed with 1 mL of 70% ethanol. After being air dried for ten minutes, the DNA pellet was dissolved in 100 µL of Tris–EDTA (TE) buffer. In a nanodrop, the DNA’s purity was examined. Polymerase chain reaction (PCR) was used to amplify the ITS region using the primers ITS1F: CTTGGTCATTTAGAGGAAGTAA and ITS4R: TCCTCCGCTTATTGATATGC in accordance with the profile: denaturation at 90 °C for 2 min, then 35 cycles of denaturation at 95 °C for 30 secs, annealing at 55 °C for 30 secs, extension at 72 °C for 1 min, and finally extension at 72 °C for 15 min1. The 5′-TEF region was amplified using EF1TF (5′-ATGGGTAAGGARGACAAGAC) and EF2TR (5′-GGAAGTACCAGTGATCATGTT) after the profile underwent an initial denaturation at 94 °C for 5 min, followed by 35 cycles at 94 °C for 40 s, 65 °C for 40 s, 72 °C for 2 min, and a final extension at 72 °C for 10 min19. The PCR product was electrophoresed in 1% agarose in 1 × TBE buffer at 120 V with GelRed nucleic acid stain and photographed with a molecular imager under UV light. For sequencing, the PCR products were sent to Macrogen, Korea.
Sequence analysis and phylogenetic tree preparation
The Sanger sequencing data of the fungal isolates were produced, and a BLAST search on the National Center for Biotechnology Information (NCBI) database was completed. The partial sequence datasets of ITS and TEF were submitted to NCBI for getting accession number. The sequences matched reference genome sequences obtained from NCBI. The Geneious V.11’s MAFT plug-in was used for multiple alignments, and the final alignment was fixed manually. Phylogenetic trees were developed by maximum likelihood analysis for the data sets using the Geneious V.11 RAxML plug-in using rapid bootstrapping and searching for the best scoring ML tree from 1000 bootstrap replicates in the GTR-GAMMA model.
Insect rearing
Eggs of S. litura were obtained from the existing culture at the Entomology Division, Bangladesh Agricultural Research Institute (BARI), Gazipur, Bangladesh. Homogenous larvae were obtained from eggs hatched on the same day. The larvae were grown in sterile plastic boxes containing pieces of okra disinfected with 0.5% (v/v) sodium hypochlorite for 10 min, maintained at 25 ± 2 °C and 65 ± 5% RH42.
Production and Collection of Beauveria conidia
Sabouraud’s Dextrose Agar (SDA) medium was used in this study. A 10 mm actively grown culture of B. bassiana was placed individually at the center of the 60 mm petri dish containing 10 mL of solid SDA media43. The inoculated plates were incubated at 28 ºC for 7 days. The conidial suspension of the isolates was then prepared by flooding the dishes with 10 mL of sterile Tween 80 (0.05%), the agar surface was gently scraped with sterile glass rods, and the suspension was collected in sterile 250 mL beakers. The suspension was then adjusted to 50 mL and mixed using a hand mixer to separate and disperse the conidia, and finally the conidial density was adjusted to 1.5 × 108 conidia per ml using a hemocytometer44. Before the bioassay experiment, conidial germination was tested on SDA agar medium.
Growth in liquid medium
A volume of 250 mL Sabouraud’s Dextrose Broth (SDB) was prepared in a 500 mL Schott bottle, and the final pH was adjusted to 6.5. The liquid broths were then inoculated with a 10 mm culture disc of the fungus. Three replications were maintained for all the B. bassiana isolates. The entire setup was kept in a shaker incubator at 25 °C temperature at 120 rpm for 10 days. White cotton ball-type growth was observed after 7 days. The mycelia were then filtered through a pre-weighed filter paper and dried in a hot air oven at 70 °C until a constant weight was obtained. This revealed the biomass production capability of all the fungal isolates 43.
Virulence of B. bassiana isolates against eggs and hatched larvae
Freshly laid egg masses that were 1–2 days old were collected and counted under a dissecting microscope. A batch of 50 eggs was separated using a hairbrush and transferred into a petri dish. A volume of 10 mL of conidial suspension (1.5 × 108 conidia/mL) was made using 0.05% Tween 80. The suspension was then sprayed over the egg masses. For control, only Tween 80 was used. Each treatment was repeated four times. 7 days after the treatment (DAT), the number of hatched and unhatched eggs was counted. The newly hatched larvae were then fed, incubated at 25 ± 2 °C, and monitored for the next 7 days. The mortality of each treatment was carefully recorded17.
Insect bioassay
Freshly laid eggs were collected and hatched to obtain homogenous larvae. The assay was conducted on 2nd instar larvae of S. litura. A set of 10 larvae in triplicate were dipped individually into a 10-mL conidial suspension of Beauveria isolates (1.5 × 108 conidia/mL) for 5 s. After treatment, transferred each set of larvae to a separate, sterile plastic box. To each box, added moist blotting paper and a piece of disinfected okra as feed. Changed the paper and feed on alternate days. At 7 DAT, the mortality of larvae was recorded according to the isolates42.
Evaluation of sublethal effects
Larvae that survived the fungal treatment were further reared until pupation at 25 ± 2 °C and 60–70% relative humidity to see the sublethal activity, such as variation in development, any kind of deformity, and longevity compared to the control. Observations were made on larval and pupal deformity, adult emergence, and any morphological deformity in various developmental stages3.
Statistical analysis
Mortality was corrected by Abbott’s formula45. The percent data were transformed by the arcsine transformation. The data were subjected to an analysis of variance (ANOVA), followed by a comparison of the means of different treatments using the least significant difference (LSD). Analyses were performed using R version 3.4.2.
Data availability
The partial sequence data of ITS and TEF genomic regions of fungal isolates during the current study are available in the NCBI repository under the Accession Numbers OP784778–OP784784 and OP785280–OP785286 (will be available on December 4 2022), respectively. The statistical datasets used and/or analyzed during the current study are available from the corresponding author upon reasonable request.
References
Islam, S. M. N. Systematics, Ecology and Plant Associations of Australian Species of the Genus Metarhizium (Queensland University of Technology, 2018).BookGoogle Scholar
Dhanapal, R., Kumar, D., Lakshmipathy, R., Rani, C. S. & Kumar, V. M. Isolation of indigenous strains of the white halo fungus as a biological control agent against 3rd instar larvae of tobacco caterpillar, Spodoptera litura (Fabricius) (Lepidoptera: Noctuidae). Egypt. J. Biol. Pest Control30, 1–5 (2020). Google Scholar
Kaur, S., Kaur, H. P., Kaur, K. & Kaur, A. Effect of different concentrations of Beauveria bassiana on development and reproductive potential of Spodoptera litura (Fabricius). J. Biopest.4, 161 (2011).CASGoogle Scholar
Mkenda, P. A. et al. Knowledge gaps among smallholder farmers hinder adoption of conservation biological control. Biocontrol Sci. Tech.30, 256–277 (2020).ArticleGoogle Scholar
Dhar, S., Jindal, V., Jariyal, M. & Gupta, V. Molecular characterization of new isolates of the entomopathogenic fungus Beauveria bassiana and their efficacy against the tobacco caterpillar, Spodoptera litura (Fabricius) (Lepidoptera: Noctuidae). Egypt. J. Biol. Pest Control29, 1–9 (2019).ArticleGoogle Scholar
Zimmermann, G. Review on safety of the entomopathogenic fungus Metarhizium anisopliae. Biocontrol Sci. Tech.17, 879–920 (2007).ArticleGoogle Scholar
Lacey, L. & Goettel, M. Current developments in microbial control of insect pests and prospects for the early 21st century. Entomophaga40, 3–27 (1995).ArticleGoogle Scholar
Kabaluk, J. T., Svircev, A. M., Goettel, M. S. & Woo, S. G. The Use and Regulation of Microbial Pesticides in Representative Jurisdictions Worldwide (International Organization for Biological Control of Noxious Animals, 2010). Google Scholar
Quesada-Moraga, E., Navas-Cortés, J. A., Maranhao, E. A., Ortiz-Urquiza, A. & Santiago-Álvarez, C. Factors affecting the occurrence and distribution of entomopathogenic fungi in natural and cultivated soils. Mycol. Res.111, 947–966 (2007).ArticlePubMedGoogle Scholar
Bateman, R., Douro-Kpindou, O., Kooyman, C., Lomer, C. & Ouambama, Z. Some observations on the dose transfer of mycoinsecticide sprays to desert locusts. Crop Prot.17, 151–158 (1998).ArticleCASGoogle Scholar
Imoulan, A., Hussain, M., Kirk, P. M., El Meziane, A. & Yao, Y.-J. Entomopathogenic fungus Beauveria: Host specificity, ecology and significance of morpho-molecular characterization in accurate taxonomic classification. J. Asia-Pac. Entomol.20, 1204–1212 (2017).ArticleGoogle Scholar
Kõljalg, U. et al. (Wiley, 2013).
Rehner, S. A. et al. Phylogeny and systematics of the anamorphic, entomopathogenic genus Beauveria. Mycologia103, 1055–1073 (2011).ArticlePubMedGoogle Scholar
Goble, T., Dames, J., Hill, M. & Moore, S. Investigation of native isolates of entomopathogenic fungi for the biological control of three citrus pests. Biocontrol Sci. Tech.21, 1193–1211 (2011).ArticleGoogle Scholar
Sain, S. K. et al. Compatibility of entomopathogenic fungi with insecticides and their efficacy for IPM of Bemisia tabaci in cotton. J. Pestic. Sci.44, 97–105 (2019).ArticleCASPubMedPubMed CentralGoogle Scholar
Idrees, A., Afzal, A., Qadir, Z. A. & Li, J. Bioassays of Beauveria bassiana isolates against the fall armyworm, Spodoptera frugiperda. J. Fungi8, 717 (2022).ArticleGoogle Scholar
Glare, T. R. & Inwood, A. J. Morphological and genetic characterisation of Beauveria spp. from New Zealand. Mycol. Res.102, 250–256 (1998).ArticleGoogle Scholar
Bischoff, J. F., Rehner, S. A. & Humber, R. A. A multilocus phylogeny of the Metarhizium anisopliae lineage. Mycologia101, 512–530 (2009).ArticleCASPubMedGoogle Scholar
White, T. J., Bruns, T., Lee, S. & Taylor, J. Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. PCR Protoc.18, 315–322 (1990). Google Scholar
Heale, J. B., Isaac, J. E. & Chandler, D. Prospects for strain improvement in entomopathogenic fungi. Pestic. Sci.26, 79–92 (1989).ArticleGoogle Scholar
Vilgalys, R. & Gonzalez, D. Organization of ribosomal DNA in the basidiomycete Thanatephorus praticola. Curr. Genet.18, 277–280 (1990).ArticleCASPubMedGoogle Scholar
Lutzoni, F. et al. Assembling the fungal tree of life: Progress, classification, and evolution of subcellular traits. Am. J. Bot.91, 1446–1480 (2004).ArticlePubMedGoogle Scholar
Boucias, D., Pendland, J. & Latge, J. Nonspecific factors involved in attachment of entomopathogenic deuteromycetes to host insect cuticle. Appl. Environ. Microbiol.54, 1795–1805 (1988).ArticleADSCASPubMedPubMed CentralGoogle Scholar
Boucias, D. G. & Pendland, J. C. The Fungal Spore and Disease Initiation in Plants and Animals 101–127 (Springer, 1991).BookGoogle Scholar
Doss, R. P., Potter, S. W., Chastagner, G. A. & Christian, J. K. Adhesion of nongerminated Botrytis cinerea conidia to several substrata. Appl. Environ. Microbiol.59, 1786–1791 (1993).ArticleADSCASPubMedPubMed CentralGoogle Scholar
Holder, D. J. & Keyhani, N. O. Adhesion of the entomopathogenic fungus Beauveria (Cordyceps) bassiana to substrata. Appl. Environ. Microbiol.71, 5260–5266 (2005).ArticleADSCASPubMedPubMed CentralGoogle Scholar
Quesada-Moraga, E. & Alain, V. Bassiacridin, a protein toxic for locusts secreted by the entomopathogenic fungus Beauveria bassiana. Mycol. Res.108, 441–452 (2004).ArticleCASPubMedGoogle Scholar
Faria, M., Lopes, R. B., Souza, D. A. & Wraight, S. P. Conidial vigor vs. viability as predictors of virulence of entomopathogenic fungi. J. Invertebr. Pathol.125, 68–72 (2015).ArticlePubMedGoogle Scholar
Petrisor, C. & Stoian, G. The role of hydrolytic enzymes produced by entomopathogenic fungi in pathogenesis of insects mini review. Roman. J. Plant Prot.10, 66–72 (2017). Google Scholar
Tseng, M.-N., Chung, C.-L. & Tzean, S.-S. Mechanisms relevant to the enhanced virulence of a dihydroxynaphthalene-melanin metabolically engineered entomopathogen. PLoS ONE9, e90473 (2014).ArticleADSPubMedPubMed CentralGoogle Scholar
Cheong, P., Glare, T. R., Rostás, M. & Haines, S. R. Microbial-Based Biopesticides 177–189 (Springer, 2016).BookGoogle Scholar
Tillman, P. Parasitism and predation of stink bug (Heteroptera: Pentatomidae) eggs in Georgia corn fields. Environ. Entomol.39, 1184–1194 (2010).ArticleCASPubMedGoogle Scholar
Kellner, R. L. The role of microorganisms for eggs and progeny. in Chemoecology of insect eggs and egg deposition, 149–164 (2002).
Cruz-Avalos, A. M., Bivián-Hernández, M. D. L. Á., Ibarra, J. E. & Del Rincón-Castro, M. C. High virulence of Mexican entomopathogenic fungi against fall armyworm, (Lepidoptera: Noctuidae). J. Econ. Entomol.112, 99–107 (2019).ArticleCASPubMedGoogle Scholar
Idrees, A. et al. Effectiveness of entomopathogenic fungi on immature stages and feeding performance of Fall Armyworm, Spodoptera frugiperda (Lepidoptera: Noctuidae) Larvae. Insects12, 1044 (2021).ArticlePubMedPubMed CentralGoogle Scholar
Khorrami, F., Mehrkhou, F., Mahmoudian, M. & Ghosta, Y. Pathogenicity of three different entomopathogenic fungi, Metarhizium anisopliae IRAN 2252, Nomuraea rileyi IRAN 1020C and Paecilomyces tenuipes IRAN 1026C against the potato tuber moth, Phthorimaea operculella Zeller (Lepidoptera: Gelechiidae). Potato Res.61, 297–308 (2018).ArticleGoogle Scholar
Ahmad, S. Enzymatic adaptations of herbivorous insects and mites to phytochemicals. J. Chem. Ecol.12, 533–560 (1986).ArticleCASPubMedGoogle Scholar
Mullin, C. A. Adaptive relationships of epoxide hydrolase in herbivorous arthropods. J. Chem. Ecol.14, 1867–1888 (1988).ArticleCASPubMedGoogle Scholar
Torrado-León, E., Montoya-Lerma, J. & Valencia-Pizo, E. Sublethal effects of Beauveria bassiana (Balsamo) Vuillemin (Deuteromycotina: Hyphomycetes) on the whitefly Bemisia tabaci (Gennadius) (Hemiptera: Aleyrodidae) under laboratory conditions. Mycopathologia162, 411–419 (2006).ArticlePubMedGoogle Scholar
Tupe, S. G., Pathan, E. K. & Deshpande, M. V. Development of Metarhizium anisopliae as a mycoinsecticide: From isolation to field performance. JoVE125, e55272 (2017). Google Scholar
Senthamizhlselvan, P., Sujeetha, J. A. R. & Jeyalakshmi, C. Growth, sporulation and biomass production of native entomopathogenic fungal isolates on a suitable medium. J. Biopest.3, 466 (2010). Google Scholar
Zhang, S., Gan, Y., Xu, B. & Xue, Y. The parasitic and lethal effects of Trichoderma longibrachiatum against Heterodera avenae. Biol. Control72, 1–8 (2014).ArticleGoogle Scholar
Abbott, W. S. A method of computing the effectiveness of an insecticide. J. Econ. Entomol18, 265–267 (1925).ArticleCASGoogle Scholar
This research was funded by the Bangladesh Academy of Science under BAS-USDA Endowment program (4th Phase BAS-USDA BSMRAU CR-13). The authors also expressed thanks to Entomology Division, Bangladesh Agricultural Research Institute (BARI), Gazipur, Bangladesh for proving supports for egg collection and rearing.
Author information
Authors and Affiliations
Institute of Biotechnology and Genetic Engineering, Bangabandhu Sheikh Mujibur Rahman Agricultural University, Gazipur, BangladeshShah Mohammad Naimul Islam, Md. Zahid Hasan Chowdhury, Mahjabin Ferdaous Mim & Tofazzal Islam
Cotton Research Training and Seed Multiplication Farm, Gazipur, BangladeshMilia Bente Momtaz
Contributions
S.M.N.I. conceptualized the idea, supervised experiments, wrote and edited the manuscript. M.Z.H.C. designed experiments, analyzed data and wrote the manuscript. M.F.M. performed fungal and molecular study, M.B.M. conducted insect bioassay, T.I. contributed in interpretation, reviewed and edited the manuscript. Correspondence and requests for materials should be addressed to S.M.N.I. or T.I.
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Rights and permissions
Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article’s Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/.
(From left) Emily Mackie, Dr Andrew Barrow and Dr Tatiana Soares da Costa.
Newswise — Weed killers of the future could soon be based on failed antibiotics.
A molecule which was initially developed to treat tuberculosis but failed to progress out of the lab as an antibiotic is now showing promise as a powerful foe for weeds that invade our gardens and cost farmers billions of dollars each year.
While the failed antibiotic wasn’t fit for its original purpose, scientists at the University of Adelaide discovered that by tweaking its structure, the molecule became effective at killing two of the most problematic weeds in Australia, annual ryegrass and wild radish, without harming bacterial and human cells.
“This discovery is a potential game changer for the agricultural industry. Many weeds are now resistant to the existing herbicides on the market, costing farmers billions of dollars each year,” said lead researcher Dr Tatiana Soares da Costa from the University of Adelaide’s Waite Research Institute.
“Using failed antibiotics as herbicides provides a short-cut for faster development of new, more effective weed killers that target damaging and invasive weeds that farmers find hard to control.”
Researchers at the University’s Herbicide and Antibiotic Innovation Lab discovered there were similarities between bacterial superbugs and weeds at a molecular level.
They exploited these similarities and, by chemically modifying the structure of a failed antibiotic, they were able to block the production of amino acid lysine, which is essential for weed growth.
“There are no commercially available herbicides on the market that work in this way. In fact, in the past 40 years, there have been hardly any new herbicides with new mechanisms of action that have entered the market,” said Dr Andrew Barrow, a postdoctoral researcher in Dr Soares da Costa’s team at the University of Adelaide’s Waite Research Institute.
It’s estimated that weeds cost the Australian agriculture industry more than $5 billion each year.
Annual ryegrass in particular is one of the most serious and costly weeds in southern Australia.
“The short-cut strategy saves valuable time and resources, and therefore could expedite the commercialisation of much needed new herbicides,” said Dr Soares da Costa.
“It’s also important to note that using failed antibiotics won’t drive antibiotic resistance because the herbicidal molecules we discovered don’t kill bacteria. They specifically target weeds, with no effects on human cells,” she said.
It’s not just farmers who could reap the benefits of this discovery. Researchers say it could also lead to the development of new weed killers to target pesky weeds growing in our backyards and driveways.
“Our re-purposing approach has the potential to discover herbicides with broad applications that can kill a variety of weeds,” said Dr Barrow.
Dr Tatiana Soares da Costa and her team are now looking at discovering more herbicidal molecules by re-purposing other failed antibiotics and partnering up with industry to introduce new and safe herbicides to the market.
Funding for this research was provided by the Australian Research Council through a DECRA Fellowship and a Discovery Project awarded to Dr Tatiana Soares da Costa.
The first author on the paper is Emily Mackie, a PhD student in Dr Soares da Costa’s team, who is supported by scholarships from the Grains and Research Development Corporation and Research Training Program. Co-authors include Dr Andrew Barrow, Dr Marie-Claire Giel, Dr Anthony Gendall and Dr Santosh Panjikar.
The Waite Research Institute stimulates and supports research and innovation across the University of Adelaide and its partners that builds capacity for Australia’s agriculture, food, and wine sectors.
Montana State alumna publishes research into wheat stem sawfly biocontrols
Reagan Colyer, MSU News Service May 19, 2023
BOZEMAN – Research from a Montana State University alumna published recently in the journal Physiological Entomology could have tangible impact for Montana agricultural producers who deal with perennial damage from wheat stem sawflies.
Laissa Cavallini, who completed her master’s degree in entomology in spring 2022, worked alongside professor David Weaver and department head Bob Peterson in the Department of Land Resources and Environmental Sciences in MSU’s College of Agriculture. The project examined two species of parasitic wasps that act as biocontrols for wheat stem sawfly. Cavallini explored the nutritional needs of those wasps to explore ways of boosting their effectiveness as biocontrols — a pest management tactic that involves using one organism to manage another.
The insects, called Bracon cephi and Bracon lissogaster, are small orange wasps that can detect the presence of wheat stem sawfly larvae inside a wheat stem. They then inject a paralyzing toxin into the sawfly larvae before laying their own eggs. When the wasp eggs hatch, the immature wasps kill and consume the immobilized sawfly.
B. lissogaster, a small wasp species that acts as a natural biocontrol to wheat stem sawfly, was the subject of a recent publication by MSU alumna Laissa Cavallini. Photo by Robert Peterson.
“Something interesting about these parasitoids and about wheat stem sawfly itself is that the organisms are all native,” said Cavallini, who completed her undergraduate work in her home country of Brazil before joining Weaver’s lab in 2018 as a graduate student. “What’s more, these two species are the only ones known to parasitize the wheat stem sawfly.”
That unique relationship means that B. cephi and B. lissogaster are naturally suited to act as biocontrols for wheat stem sawflies but are limited by a short lifespan in wheat fields. Cavallini’s work examined the nutritional needs of the parasitic wasps to see if their diet could increase their lifespan and potentially make them more effective management tools.
“I thought it was a nice opportunity to work with parasitoids and look into controlling insect pests in a way that’s less harmful to the environment,” said Cavallini. “We already knew that some parasitoids were able to feed on nectar, but we didn’t have a lot of information in the beginning. We saw an opportunity to see if that was the same here in Montana.”
Because Montana has a dry, arid climate, Cavallini said, it was necessary to identify whether the wasps could readily access plant nectar as a food and water source. Depending on the type of plant, a lack of water could mean the nectar forms crystals that are difficult to consume or, most often, the nectar is stored in a part of the plant that the small insects can’t easily reach. Cavallini built on research done by a previous graduate student, Dayane Reis, to determine whether ingesting sugar had an impact on the wasps’ lifespan. The insects were fed sucrose, the same type of sugar that they would get from plant nectar.
“We noticed that sugars helped them a lot,” Cavallini said. “They need this resource. Feeding on water, they would live for two to five days, and feeding on sugar, some of them lived for 60 days or longer.”
It was an important finding, Cavallini said, and it confirmed the hypothesis that nectar could make a large difference in the effectiveness of the parasitoids as biocontrols. But the team still had to gauge whether the wasps could access plant nectar on or near agricultural fields, so they next investigated whether the lab findings could be replicated in an agricultural setting and explored crops that could serve as a source of nectar.
Cowpea, a pulse crop that produces extrafloral nectar, could be a viable food source for two species of wasps that act as natural biocontrols for wheat stem sawflies.
Ultimately, the team identified cowpea as a potential partner crop to serve as a food source for the two parasitoid species. A type of pulse crop, cowpea was appealing for several reasons. It produces extrafloral nectar, meaning its nectar is more easily accessible for insects like B. cephi and B. lissogaster, providing an ideal food source to help them live longer and work more effectively in wheat stem sawfly management. Additionally, heat and drought tolerant cowpea also provides many of the same benefits as other pulse crops, like peas and lentils. It fixes nitrogen in soil, reducing the need for nitrogen fertilizer, and it helps to prevent erosion and maintain soil moisture, making it a good candidate as a rotational crop in years when a field may otherwise be left fallow, said Cavallini.
“Another important part of this research is that we don’t have cowpea being widely grown in Montana,” she said. “We didn’t know if the parasitoids, which are native, would be attracted to it. But we found that they were able to perceive odors from cowpea plants and move to feed on the extrafloral nectar.”
Because the experiments with cowpea were done in a lab, Cavallini said field tests are needed to determine if those results can be replicated on a farm. She added that incorporating this biocontrol could be effective alongside the development of solid-stemmed wheat varieties that are more difficult for sawflies to burrow into. As Cavallini moves on to a doctoral program at North Carolina State University, she hopes future graduate students at MSU will continue those explorations.
“Altogether, this research has the potential to have important impacts on how wheat stem sawfly is managed in Montana,” Cavallini said.
David Weaver, Department of Land Resources and Environmental Sciences, weaver@montana.edu or 406-994-7608
Republishing
You may republish MSU News Service articles for free, online or in print. Questions? Contact us at msunews@montana.edu or 406-994-4565.
Address the growing urgency of fungal disease in crops
More political and public awareness of the plight of the world’s crops when it comes to fungal disease is crucial to stave off a major threat to global food security.
Clouds of dust caused by a fungus engulf a crop field. Credit: Darren Hauck/Reuters
In October 2022, the World Health Organization (WHO) published its first list of fungal pathogens that infect humans, and warned that certain increasingly abundant disease-causing fungal strains have acquired resistance to known antifungals1. Even though more than 1.5 million people die each year from fungal diseases, the WHO’s list is the first global effort to systematically prioritize surveillance, research and development, and public-health interventions for fungal pathogens.
Yet fungi pose another major threat to human health — one that has received even less attention than infections in people.
Hundreds of fungal diseases affect the 168 crops listed as important in human nutrition by the Food and Agricultural Organization (FAO) of the United Nations. Despite widespread spraying of fungicides and the planting of cultivars bred to be more disease resilient, growers worldwide lose between 10% and 23% of their crops to fungal disease every year, and another 10–20% post-harvest2. In fact, the five most important calorie crops — rice, wheat, maize (corn), soya beans and potatoes — can be affected by rice blast fungus, wheat stem rust, corn smut, soybean rust and potato late blight disease (caused by a water mould oomycete), respectively. And losses from these fungi equate to enough food to provide some 600 million to 4,000 million people with 2,000 calories every day for one year3. Such losses are likely to increase in a warming world4,5.
Much more awareness of the plight of the world’s crops as a result of fungal disease is needed, as is more government and private- sector investment in crop fungal research.
Adaptive potential unleashed
In a 2019 list of 137 pests and pathogens (ranked according to impact), fungi dominate the first to sixth places for diseases affecting each of the world’s 5 most important calorie crops6. Wheat, for example, is grown over more land area than any other crop, with production yielding around 18% of all the calories consumed globally each year. Despite mitigation practices, current crop losses worldwide from infections by the Septoria tritici blotch disease-causing fungus Zymoseptoriatritici, the main wheat pathogen in temperate areas, range from 5% to 50%7. Losses caused by the wheat stem rust fungus Pucciniagraminis, which frequents more tropical climates, range from 10% to 70% of the harvest3. Commodity crops, such as bananas and coffee, which in many countries generate revenue that is used to purchase calorie crops, are also vulnerable to fungal diseases.Bacterial defence repurposed to fight blight
Fungi are hugely effective pathogens. They produce massive amounts of spores. The spores of some species can persist in soil and remain viable for up to 40 years. In other species, airborne spores can disperse over distances ranging from a few metres to hundreds or even thousands of kilometres. Wheat stem rust, for example, produces airborne spores that can travel between continents8, although many other fungi produce prolific numbers of spores more locally, promoting disease spread within and between adjacent fields.
Fungi also exhibit a phenomenal degree of genetic variation and plasticity9. Over the past decade or so, genome-wide studies have revealed extensive genetic diversity between and within species of fungi. Although some fungal pathogens undergo frequent sexual recombination, genetic variation can be generated through other processes, too. These include mutational changes conferred by transposable elements (DNA sequences that can change their position in the genome), mitotic (asexual) recombination and the horizontal transfer of genetic material — in some cases, between fungal species, or between fungi and bacteria or plants.
A perfect storm
Current problems have arisen because the adaptability of fungi has met modern agricultural practices.
Most monocultures entail vast areas of genetically uniform crops. (The world’s largest monoculture is a field of more than 14,000 hectares of genetically uniform wheat in Canada.) These provide ideal feeding and breeding grounds for such a prolific and fast-evolving group of organisms. Added to this, the increasingly widespread use of antifungal treatments that target a single fungal cellular process (for example, compounds called azoles target an enzyme needed for the formation of fungal cell membranes) has led to the emergence of fungicide resistance.
Source: T. M. Heick et al. in Applied Crop Protection 2018 Ch. 4 (DCA, 2018)
Together, the azoles, the strobilurins and the succinate dehydrogenase inhibitors (all of which are single-target-site antifungals) comprise more than 77% of the global fungicide market10. Moreover, between 2021 and 2028, the market for fungicides is projected to grow by around 4.9% per year — largely thanks to increasing use in low-income countries.
An open question is how the impacts of fungal diseases on crops will be affected by climate change. Although little is known about the response of major plant pathogens to climate change, increasing temperatures in the Northern Hemisphere will drive the evolution of new temperature tolerances in fungal pathogens, and the establishment of pathogens that previously were restricted to more southerly regions4,5. In fact, since the 1990s, fungal pathogens have been moving polewards at around 7 km per year4. Growers have already reported wheat stem rust infections — which normally occur in the tropics — in Ireland and England.
Increasing temperatures might also affect interactions between plants and their microbiomes, including endophytic fungi (symbionts that live in plants). Harmless endophytic fungi could become pathogenic as plants change their physiologies in response to environmental stresses11, which has been demonstrated in studies of the model plant Arabidopsisthaliana12. Moreover, tolerance to higher temperatures in fungi could increase the likelihood of opportunistic soil-dwelling pathogens hopping hosts, and becoming pathogenic in animals or humans13.
With the pressures on the food system from a growing human population added to these problems — over the next 30 years, the global population is projected to grow to 9.7 billion — humanity is on track for unprecedented challenges to food production.
Early promise
Better protecting the world’s crops from fungal disease will require a much more unified approach than has been achieved so far — with closer collaboration between farmers, the agricultural industry, plant breeders, plant-disease biologists, governments and policymakers, even philanthropic funders.
It is no longer enough to focus on crop husbandry (such as the clearing or burning of diseased plant tissues), conventional methods of breeding plants for single disease-resistance genes, or the spraying of predominantly single-target-site fungicides. Growers and other stakeholders must exploit various technical innovations to more effectively monitor, manage and mitigate plant disease. Several approaches are already being developed or used to limit disease impacts and protect crop yields; in combination, these approaches could help farmers to sustain their yields in the coming decades.
Discovery and development of antifungals. The development of fungicides has been largely orchestrated in the agrochemical crop-protection industry. It has so far relied on the serendipitous discovery of antifungals following large-scale screening of compounds, such as the by-products of the pharmaceutical industry — and, since the 1980s, on the synthesis of chemical variants of known compounds, such as the strobilurins and the azoles.
However, it is time to move away from reliance on single-target-site fungicides, and to search for compounds that target multiple processes in the pathogen. In 2020, an inter-disciplinary research team at the University of Exeter, UK, revealed an interesting candidate molecule — a lipophilic cation (C18-SMe2+) that targets several fungal processes (including the synthesis of the energy-carrying molecule ATP, as well as programmed cell death)14. This molecule provides significant crop protection against Septoria tritici blotch in wheat, rice blast in rice13 and Panama TR4 disease in bananas15.
Corn smut, a disease caused by the fungus Ustilago maydis, affects maize (corn) crops.Credit: Getty
Increasing diversity in agricultural fields. Planting seed mixtures that combine several crop cultivars carrying different resistance genes could provide an important way to slow down pathogen evolution.
In 2022, around 25% of the total wheat production in Denmark used mixed cultivars, selected because they grow at a similar pace and carry complementary disease-resistance genes. This collaborative venture (involving breeders, farmers, environmentalists and scientists) provided promising results in terms of reducing the severity of both Septoria tritici blotch and yellow and brown rust in mixed cultivars without incurring yield loss (L. Nistrup Jørgensen, pers. comm.).
Indeed, these cultivars could reduce the spread of disease and the erosion of crop-resistance genes16.
Early disease detection and surveillance. Artificial intelligence (AI), satellites, remote- sensing tools (such as drones), incentives to persuade farmers to report disease and community-science projects that engage the public in the reporting of plant diseases (both in crops and in wild species) are beginning to engender more effective surveillance of fungal disease.
A collaborative scientist initiative called OpenWheatBlast aims to collect research outputs and data on the emerging wheat blast disease. The fast and easy data sharing allows discoveries to be made, resulting in faster disease control (see go.nature.com/42s25a3). Meanwhile, for the Cape Citizen Science project, an initiative funded by Stellenbosch University in South Africa, researchers are asking people who are interested in science to hunt for the oomycete Phytophthora spp. in South African vegetation (https://citsci.co.za/disease/) — to create records of the presence and spread of this pathogen.
Data collected through AI, community- science projects and so on could be integrated with disease records and collated into, for example, the PlantwisePlus programme (see go.nature.com/3mlgxnn) led by the Centre for Agricultural and Bioscience International, a non-profit intergovernmental organization. The results could also be integrated with climate data obtained from meteorological offices (for example, see go.nature.com/3ukk5hu) and so inform the building of models that predict when and where plant fungal diseases will occur5. More accurate disease predictions could, in turn, trigger early interventions to offset the loss of crops.
A quarantined banana farm near Cairns in Queensland, Australia.Credit: Suzanne Long/Alamy
Disease resistance and plant immunity. Conventional plant-breeding practices have involved introducing into a given cultivar one or two genes that confer resistance to a particular disease, known as R genes. But although pathogens can overcome this R-gene-mediated resistance in a few years, it can take 10–20 years to go from researchers unmasking an R gene to an agriculture company selling the new cultivar. Incorporating two or more R genes (known as R-gene pyramiding or stacking) can broaden resistance to a diversity of pathogens. Yet field studies have documented how resistance achieved through this means can be short-lived17.
Most R genes encode proteins with a nucleotide-binding site and a leucine-rich repeat region, which act as receptors in the plant cell. These receptors recognize particular pathogen-produced molecules. However, plants possess an earlier detection system for pathogens, involving extracellular receptor proteins that recognize pathogen elicitor molecules, such as chitin and glucan. (Chitin and glucan are present in the fungal cell wall.) These receptors are known as pattern-recognition receptors (PRRs). This type of ‘immune boosting’ could be combined with new R-gene-edited cultivars or through R-gene pyramiding using conventional breeding to provide more durable and broader resistance to major pathogens.
A significant barrier to exploiting this approach in a way that is fast and efficient — particularly in Europe — is public and political resistance to the use of transgenic plants. In March, however, the UK Genetic Technology (Precision Breeding) Act was passed into law; this will enable the development and marketing of gene-edited crops in the United Kingdom. In principle, practices such as ‘immune boosting’, combined with the incorporation of two or more R genes into crops, could endow more durable and broader disease resistance.
Exploiting biologics and crop biotics. Biologics are a broad category of products derived from living organisms. Just as interest in probiotics in medicine has grown over the past decade, so too has interest in the use of biologics in crop protection. This is evidenced by the projected rise in investment by governments and stakeholders.
Strategies currently being explored include the exploitation of living antagonists of plant pathogens, such as the fungus Trichoderma spp., and spraying crops with natural antimicrobial compounds, such as polyoxins, which inhibit the synthesis of chitin (for example, polyoxin D zinc salt)18. Trichoderma strains can impede fungal phytopathogens either indirectly, for example by competing for nutrients and space, or directly, by parasitizing fungi. And in the past decade, researchers have identified other fungal and bacterial endophytes that can help to suppress disease.Indigenous knowledge is key to sustainable food systems
Plants do not grow alone — they associate with diverse microbial communities, which can play a part in plant development, stress tolerance and disease resistance. Over the past decade, new methods for profiling microbes have revealed the existence of beneficial microbial networks. The discovery that some microbial species always co-occur, whereas others never do, is essential knowledge in the design of consortia of microbes that can be applied to soil to promote plant growth and enhance disease protection. Indeed, the challenges ahead will include translating these discoveries from laboratory settings to fields of crops, and ensuring that synthetic, beneficial microbial communities persist once they are introduced, and do not adversely affect the native microbiota, or become pathogenic themselves18.
RNA trafficking between plants and fungi. In 2013, a research team showed that small RNAs (sRNAs) from the grey mould fungus Botrytiscinerea can silence plant host genes involved in immunity19. Some of the researchers then showed that double stranded RNAs (dsRNAs) and sRNAs from the fungus could protect vegetables and fruit against grey mould disease for up to ten days20. However, RNAs (usually encapsulated in tiny vesicles) are not only transferred from the fungus to the host — plant hosts also dispatch vesicles to suppress fungal virulence genes.
A growing number of researchers and newly founded technology companies are now looking to harness these naturally occurring RNA interference (RNAi) based trafficking systems to better protect crops against fungal disease. Currently, investigators are exploring two possible ways of using RNAs. One of these, called host-induced gene silencing or HIGS, relies on the genetic modification of crops. But this approach is lengthy, costly and can’t be implemented in the many countries where genetically modified plants remain banned. Therefore the main focus is now on spray-induced gene silencing or SIGS, in which sRNAs or dsRNAs are directly applied to plants, as a new, environmentally friendly and non-genetically modified crop-protection strategy21.
Several studies have documented the efficacy of RNAi in providing resistance to common fungal pathogens22. However, research is still needed to understand how these external RNAs are taken up and transported between the plant and fungal cells. Moreover, although progress is being made in the application of RNAs to crops, questions remain about the stability of the molecules.
A global body for plant health
Between January 2020 and January 2023, the UK Research and Innovation (UKRI) council allocated around US$686 million to COVID-19 research, and almost 225,000 papers on COVID-19 were published globally. (We conducted a search on the Scopus and Web of Science databases, using ‘COVID’ and ‘SARS-CoV-2’ as keywords.) During the same period, the UKRI spent around $30 million on fungal crop research and, globally, around 4,000 papers on crops and fungal disease were published. (Scopus and Web of Science key words were ‘crops’ and ‘fungal disease’.) Given that food security engenders health and well-being, agriculture and farmers are arguably just as crucial to human health as medicine and health-care providers.
Addressing the threat to human health posed by fungal crop diseases will require greater engagement with the problem, and more investment in research from governments, philanthropic organizations and private companies.
The International Plant Protection Convention (IPPC) is a body supported by the FAO that aims to protect the world’s plant resources from pathogens. It is much less well known than other bodies that deal with threats to human well-being, such as the WHO. The 180 member states that are signatories of the IPPC treaty must work together to change that.
Because viruses and bacteria dominate as agents of human disease, these microbes have received much more attention than have fungi. Yet in crops, fungi are by far the most important agents of disease. The WHO’s list of fungal pathogens that infect humans is a step towards bringing more attention to this extraordinary but understudied group of microbes. But addressing the greatest threats to food security — and so to human health — must include tending to the devastating impacts fungi are having, and will keep having, on the world’s food supply.
Sign up for the Nature Briefing newsletter — what matters in science, free to your inbox daily. Email address I agree my information will be processed in accordance with the Nature and Springer Nature Limited Privacy Policy.
INRAE – National Research Institute for Agriculture, Food and Environment
The Egyptian cotton leafworm (Spodoptera littoralis) is a pest species in France. It is found throughout the Mediterranean Basin as well as in Africa and the Middle East. Moth larvae are extremely polyphagous[1] and cause damage to diverse crop species (e.g., corn, legumes, cotton, tomatoes, peppers). As part of broader efforts to reduce pesticide levels, we must develop effective biocontrol methods. Such strategies often rely on disrupting reproduction and trapping moths using, most commonly, sex pheromones. However, pheromone synthesis is an expensive process, and it thus remains important to have other control strategies on hand. To this end, we need to improve our understanding of olfactory receptors in this moth.
In 2019, these research collaborators identified OR5, an olfactory receptor in the Egyptian cotton leafworm that recognises the main compound in the female sex pheromone blend. In this new study, the scientists explored the receptor’s evolutionary trajectory within Spodoptera to better characterise its functionality and specificity. They used a combined approach in which they resurrected ancestral receptors in the laboratory, with the help of computer analysis, and they modelled the 3D structure of the receptors. They were thus able to determine that OR5 appeared around 7 million years ago. The researchers also employed site-directed mutagenesis[2] to explore OR5’s genetic fine-tuning, which allowed them to identify the eight amino acids (AAs) behind the receptor’s high degree of specificity. This finding is particularly unexpected, given that past research on receptor evolution has suggested just one or two AA substitutions suffice to change the functionality of ecologically important receptors.
We must clarify how olfactory receptors emerge and acquire specificity over evolutionary time if we wish to anticipate the development of resistance to pheromone-based plant protection products. This research advances the above goal and, additionally, clarifies the function of OR5, a highly specific receptor that is essential in the reproduction of two Spodoptera species—the Egyptian cotton leafworm and the tobacco cutworm (S. litura). The latter occurs mostly in Asia and is also polyphagous. The discoveries detailed above will help spur the development of new biocontrol strategies that rely on (1) agonist molecules, which occupy receptors to the exclusion of the key pheromone compound, or (2) antagonist molecules, which block the receptor from being activated by the key pheromone compound.
This study arose from a collaboration between the Institute of Ecology and Environmental Sciences of Paris (iEES Paris; under the aegis of INRAE, Sorbonne University, CNRS, IRD, UPEC, and Paris Cité University) and the Chinese National Institute of Plant Protection. It was the fruit of the BiPi International Associated Laboratory.
[1]Polyphagous organisms feed on many different species
[2]Site-directed mutagenesis is a technique that introduces one or more precise mutations into a gene to study the functional impacts on the encoded protein.
/Public Release. This material from the originating organization/author(s) might be of the point-in-time nature, and edited for clarity, style and length. Mirage.News does not take institutional positions or sides, and all views, positions, and conclusions expressed herein are solely those of the author(s).View in full here.
Global Plant Protection News 