Feeds:
Posts
Comments

May 27, 2023 by IAPPS

Scientific Reports

Biocontrol potential of native isolates of Beauveria bassiana against cotton leafworm Spodoptera litura (Fabricius)

Scientific Reports volume 13, Article number: 8331 (2023) Cite this article

Abstract

The entomopathogenic fungus (EPF), Beauveria bassiana, is reported as the most potent biological control agent against a wide range of insect families. This study aimed to isolate and characterize the native B. bassiana from various soil habitats in Bangladesh and to evaluate the bio-efficacy of these isolates against an important vegetable insect pest, Spodoptera litura. Seven isolates from Bangladeshi soils were characterized as B. bassiana using genomic analysis. Among the isolates, TGS2.3 showed the highest mortality rate (82%) against the 2nd instar larvae of S. litura at 7 days after treatment (DAT). This isolate was further bioassayed against different stages of S. litura and found that TGS2.3 induced 81, 57, 94, 84, 75, 65, and 57% overall mortality at egg, neonatal 1st, 2nd, 3rd, 4th, and 5th instar larvae, respectively, over 7 DAT. Interestingly, treatment with B. bassiana isolate TGS2.3 resulted in pupal and adult deformities as well as decreased adult emergence of S. litura. Taken together, our results suggest that a native isolate of B. bassiana TGS2.3 is a potential biocontrol agent against the destructive insect pest S. litura. However, further studies are needed to evaluate the bio-efficacy of this promising native isolate in planta and field conditions.

Introduction

The reduction of crop losses due to insects is becoming a bigger challenge for the world’s food production. Due to concerns about their impact on human health, the environment, and the food chain, many of the older, less expensive chemical insecticides are no longer being registered1. New technologies like expensive, more selective chemicals and genetic modification are being used, but this increased selection pressure accelerates the evolution of resistance in insect pests. Global agriculture urgently needs more environmentally friendly pest management techniques.

The tobacco caterpillar, Spodoptera litura (Fabricius) (Lepidoptera: Noctuidae), is one of the most devastating pests of 120 crop plants, including cauliflower, groundnuts, cotton, onions, tomatoes, brinjal, turnips, and cabbage2. Each year, it goes through five to six overlapping generations, and if it is not promptly treated, it might cause significant crop losses up to complete destruction3. Insecticides are the most often used method for controlling this problem. Although this is effective in reducing pest populations in the short term, long-term exposure to insecticides may cause S. litura to develop the 3 R’s issues, viz., resistance, resurgence of insects, and residues on crops, like other Noctuidae members4. In addition, the use of pesticides leads to ecological imbalances by destroying non-target organisms and their natural enemies, parasites, and predators. The public’s growing concern over the potential ecological and health risks of synthetic pesticides has shifted the focus of research toward more environmentally benign methods for controlling insect pests5.

Insect-pathogenic or entomopathogenic fungi (EFP) (Fungi: Ascomycota, Order: Hypocreales) cause disease in insects. These entomopathogens are used as biocontrol agents, or “biopesticides,” for the management of insect pests6. They provide an alternative to chemical insecticides for protecting crops7 and reducing the harmful environmental impacts of chemical insecticides8. An increasing number of products based on EPF are being registered as insecticides and used in developed and developing countries like the United States of America, the United Kingdom, Australia, Canada, China, India, etc.8.

Among the members of the genus Hypocreales, Lecanicillium sp., Beauveria sp., and Metarhizium sp. have been effectively used to control aphids, lepidopteron larvae, and other pests9. Among them, Beauveria bassiana (Balsamo) Vuillemin is responsible for causing white muscardine disease in a variety of insects. Beauveria infects the insect by degrading the host cuticle using mechanical and chemical forces, which are particularly advantageous in pest control because direct ingestion of fungal propagules is not needed by insects, thus also becoming active against the non-feeding stages of insects10. In addition, among the cyclic hexadepsipeptide mycotoxins produced by the different EPF, beauvericin, produced by B. bassiana, has shown the most effective larvicidal properties11.

Like other Hypocreales, the species of Beauveria show pleomorphic life stages. They are often described as cryptic fungi, i.e., morphological characteristics are changed in response to the environment, and thus morphological description fails to clarify their systematics at species level12. Nowadays, researchers are using polymerase chain reaction (PCR) based molecular techniques to reconstruct the Beauveria phylogeny for accurate identification of Beauveria species. Among the molecular markers, the internal transcribed spacer (ITS) region of rDNA is considered a universal bar code for fungus identification13. But in case of Hypocreales, ITS analysis produced low resolution in many cases and failed to resolve the phylogeny of Beauveria14. Additional genomic markers like translation elongation factor-1α (TEF) are needed for the species-level determination of Beauveria to be made correctly14.

Although B. bassiana showed a broad spectrum of pathogenicity against a wide range of insects, its bio-efficacy depends on the isolation source and life stages of the target stages. Insecticide resistance and resurgence issues can be effectively addressed by controlling insect pests with local isolates of fungus15. These native isolates also have higher survival and persistence abilities under local environmental conditions16. In conservation agriculture guidelines, it is also important to isolate potential native bioagents to prevent contamination from imported biopesticides. In addition, the pathogenicity of the biocontrol agent differs according to the different life stages of the target insect17. Identification of the more suspectable stage of insects against fungal inoculum increases the bio-efficacy of biological control strategies in field conditions. Therefore, the present investigation was carried out to isolate and molecularly characterize native Beauveria isolates and test their bio-efficacy against different life stages of S. litura.

Results

Isolates of Beauveria

Among the isolated fungal isolates on selective medium, seven isolates showed characteristics of the morphology of Beuaveria species. The single fungal colonies of the isolates were white in color, round, lightly elevated with a powdery appearance, and lightly downy with circular rings. Conidia were hyaline and round. Single cell conidiophores were short, densely clustered, and hyaline (Fig. 1).

figure 1
Figure 1

Molecular identification and phylogeny of Beauveria isolates

The partial sequence datasets of ITS and TEF were processed and analyzed individually through Geneious V.11 software, and accession numbers were obtained from NCBI (Table 1). The genomic ITS and TEF data of seven isolated Beauveria isolates showed BLAST similarity, with many references to B. bassiana in BLAST search results in the NCBI database. The reconstructed maximum likelihood phylogenetic tree of the ITS data set showed that the seven morphologically characteristic isolates were clustered with the reference B. bassiana isolate with a moderate bootstrap support value (60%) (Fig. 2). Furthermore, a tree constructed with the TEF data set showed the maximum support (100%) for the clade containing isolated Beauveria isolates and references to B. bassiana (Fig. 3). Thus, both the ITS and TEF data sets confirmed the isolated strains as B. bassiana.Table 1 NCBI accession numbers of isolated B. bassiana isolates.

Full size table

figure 2
Figure 2
figure 3
Figure 3

Biomass production of the fungal isolates

Overall mean mycelial growth revealed that the fungal isolate TGS2.3 (388.27 ± 10.29 mg/100 mL) exhibited the highest biomass production, and the lowest growth was observed in TGS1.2 (208.8 ± 8.03 mg/100 mL) (Fig. 4).

figure 4
Figure 4

Insect bioassay

Seven days following infection of the 2nd larval instar by seven B. bassiana isolates revealed that TGS2.3 had the highest mortality rates (81.72 ± 2.15%) followed by TGS2.1 (72.40 ± 3.46%), BeauD1 (61.29 ± 1.08%), BeauA1 (51.61 ± 2.15%), KSS1.1 (49.46 ± 4.69%), TGS1.2 (46.59 ± 2.71%), and KSS2.2 (43.73 ± 3.78%) (Fig. 5).

figure 5
Figure 5

The findings implied that the death of 2nd instar larvae of S. litura treated with TGS2.3 and TGS2.1 occurred mostly during the first two days of infection, especially on the first day for TGS2.3. The mortality was caused more gradually from day-one to day-seven by the other Beauveria isolates, viz. BeauA1, BeauD1, KSS1.1, KSS1.2, KSS2.2, and TGS1.2 (Fig. 6).

figure 6
Figure 6

As the first day was when the most deaths occurred, results were statistically analyzed to ascertain which isolates induced the highest day-one mortality (causing high mortality within 24 h of infection). Samples infected with TGS2.3 (56.67 ± 7.02%) had the highest day-one mortality, followed by TGS2.1 (43.33 ± 3.51%) (Fig. 7).

figure 7
Figure 7

Hatchability and neonate larval mortality after TGS2.3 treatment

Egg hatchability was drastically reduced in the TGS2.3-treated eggs compared to the control. The isolate TGS2.3 induced 81.25 ± 2.75% egg mortality, whereas in control it was 18.5 ± 2.65% (Fig. 8). The 7-days post treatment data also revealed that TGS2.3 induced 57.25 ± 6.34% neonatal larval mortality, whereas in control it was 8.25 ± 2.63% (Fig. 9).

figure 8
Figure 8
figure 9
Figure 9

Bioassay against different larval stages of S. litura by B. bassiana isolate TGS2.3

The larvae treated with the TGS2.3 isolate succumbed to fungal infection and showed different mortality rates in various larval stages. The highest mortality was recorded in 1st instar larvae (94.45 ± 4.60%) and the lowest was in 5th instar larvae (56.56 ± 2.07%). The mortality rates in 3rd and 4th instar larvae were statistically similar (Fig. 10).

figure 10
Figure 10

Cumulative mortality over 7 days demonstrates that 1st instar larvae had the highest day-one mortality, which progressively rose until the 4th day. The death of 2nd instar larvae began on day-one and subsequently increased until day-five. The 3rd instar larvae did not die until the 3rd day, and the death rate progressed until the 6th day. The death of larvae in the 4th and 5th instars occurred on the 4th day and subsequently increased until the 7th day (Fig. 11). Overall, the mortality across various time points revealed all larval instars of S. litura to be susceptible to the fungus TGS2.3.

figure 11
Figure 11

Mycosis and sub-lethal effects

The mobility of the infected larvae was reduced. The larvae were stiff and rigid after dying. Within two days of death, the deceased larvae began to produce mycelium. (Fig. 12). The B. bassiana infection was verified by the slides prepared from this fungus’ growth. When compared to control larvae, B. bassiana negatively impacted the emergence of adults from the 2nd, 3rd, 4th, and 5th instars. A smaller number of adults (7.11–37.94%) emerged from fungus treated larvae than from control larvae (94%) (Fig. 13).

figure 12
Figure 12
figure 13
Figure 13

Deformities

The fungal infection caused a wide range of abnormalities. When some of the treated larvae molted into pupae, they did not entirely detach from the exuvium (Fig. 14). Some pupae lacked a completely developed cuticle. When 2nd instar larvae were treated with B. bassiana, they had 9.33 ± 2.08 percent pupal deformities. Similarly, the pupal deformity was 7.67 ± 1.53, 10 ± 2 and 6.67 ± 1.53 percent owing to the treatment of 3rd, 4th, and 5th instar larvae, respectively (Fig. 15). Adults developed from fungus infected larvae had 3.67–10% deformities (Fig. 16) with folded, undeveloped wings (Fig. 17). The control group, however, showed no deformation.

figure 14
Figure 14
figure 15
Figure 15
figure 16
Figure 16
figure 17
Figure 17

Discussion

The tobacco caterpillar (S. litura) is one of the most devastating pests of various crops. Insecticides are the most commonly used method for controlling this problem. The use of pesticides leads to ecological imbalances by destroying non-target organisms and their natural enemies, parasites, and predators. The public’s growing concern over the potential ecological and health risks of synthetic pesticides has shifted the focus of research toward more environmentally benign methods. Among them, B. bassiana causes white muscardine disease in a wide range of insects. Insecticide resistance and resurgence issues can be effectively addressed by controlling insect pests with local isolates of fungus and targeting more suspectable stages of insects.

In this study, seven B. bassiana isolates were isolated from soil samples and reported for the first time in Bangladesh as local isolates. The morphology described by previous studies5,18.was similar to that of our seven isolates. The ITS phylogeny produced a moderate support value for these seven isolates, which confirmed the inadequacy of the ITS analysis that had been previously reported1,14,19. However, ITS could be used for quick screening of a wide range of field isolates because of its PCR amplification efficiency20,21,22 and the availability of reference data23. Further molecular analysis with TEF data supported the phylogenetic position of seven isolates in the B. bassiana clade very strongly and proved its efficiency in resolving phylogenies for Hypocreales fungi1,14,19.

To find the best insect pathogenic B. bassiana isolate, the overall and daily mortality of 2nd instar larvae was investigated to determine the mortality induced by each fungal isolate. The highest mortality rate was induced by B. bassiana isolate TGS2.3 and could be because of higher insect pathogenic properties like conidial adhesion, germination rate, growth condition, or the production of enzymes or secondary metabolites. The very first stage of fungal infection is conidial attachment, and the strength of conidial attachment is a crucial indicator of the virulence of an entomopathogenic fungus. Fungal cell attachment to the cuticle may involve specific receptor-ligand and/or nonspecific hydrophobic and electrostatic mechanisms24,25,26. If the adhesion strength of EPF is weakened, then it could result in the washing off of the conidia from the host, thus preventing the infection27. The fluctuation of virulence among different isolates of B. bassiana may be due to their different levels of hydrophobic nature or their biochemistry.

Secondary metabolite synthesis might let EPF get past the immunological defenses of the insects and hasten mycosis6. According to some research, EPF B. bassiana creates host-specific secondary metabolites that, at low quantities, may result in 50% mortality11,28. The strain TGS2.3, which showed the highest insect mortality rate, may produce biologically active compounds with insecticidal activity against S. liturta. Further investigation is required to determine the bioactive compounds produced by B. bassiana isolate TGS2.3. The investigation and production of these compounds may open up new arrays of possibilities for controlling invasive crop pests.

The parameters, such as conidial germination and the production of hydrolytic enzymes are associated with the virulence of EPF21,29,30,31. A faster germination rate was found to exhibit higher virulence in B. bassiana29. The day-one mortality of TGS2.3 was the highest among all the isolates, which suggested that TGS2.3 has a higher germination rate. Hydrolytic enzymes such as protease, chitinase, and lipase are secreted by EPF to degrade the cuticle of host species to infect them32. Higher enzyme activity may be one of the reasons for the higher virulence of TGS2.3. Further investigation is needed to verify these hypotheses for our high-performing Beauveria candidate, TGS2.3.

The immobility of eggs is the main reason for insect vulnerability to microbial infections33. The nutrient requirement of an egg to develop into a hatchling is excessive, and they are highly targeted by pathogenic microbes at this stage34. This study showed that the eggs of S. litura were highly susceptible to TGS2.3. Similar results were found in previous studies where B. bassiana induced egg mortality in S. frugiperda35,36 and Phthorimaea operculella37. The isolate TGS2.3 also induced mortality in neonate larvae, which is similar to another study conducted by Idrees et al.17.

The mortality of larvae was highest in the 1st instar, and it gradually decreased with the advancement of each stage. The 1st instar larvae experienced 38% higher mortality than the 5th instar larvae. This indicates the decreased susceptibility of larvae with age. Shweta and Simon38 used B. bassiana against S. litura Fab. (Tobacco Caterpillar) in which the 1st and 2nd instar larvae showed higher mortality than the later stages. These variations in mortality between various instars might be attributed to enzymatic activity. According to different studies, detoxification enzyme activity changes significantly across and within developmental stages. The activity is modest in the egg stage, rises with each larval or nymphal instar, and ultimately decreases to zero during pupation39,40.

The EPF isolate TGS2.3 demonstrated sub-lethality over the life stages of S. litura. Pupal and adult deformities were produced as a consequence of the fungal infection in the larval stage. The larvae were unable to adequately transition into pupae. Insect molting has reportedly been hampered by B. bassiana41. Since the development of new cuticles during the molting process heavily depends on nutrients, any stage in the process might be affected if there is a nutritional imbalance in the hemolymph caused by a fungal infection. This sub-lethality of B. bassiana isolate TGS2.3 suggests a relatively prolonged sub-lethal influence of the fungi on S.litura, which may reduce S.litura populations more effectively in addition to direct mortality.

In summary, this study found that, the most potent isolate, TGS2.3, was effective against egg hatching and all stages of S. litura caterpillars and suggested that this fungal isolate could be utilized to target both the hatching and feeding stages of this target insect. Alongside, early stages of larval development of S. litura were more susceptible to fungal infection. The sub-lethal effects also demonstrated that once exposed to an entomopathogen, B. bassiana isolate TGS2.3 has the capability to kill insects at any descendant life stage of insect and reduce adult emergence. This study warrants further in planta evaluation in both laboratory and field conditions to evaluate the bio-efficacy of native B. bassiana isolates precisely. However, the findings of this research provided the potential for developing alternative S. litura pest control techniques as well as for limiting the use of synthetic pesticides, thereby minimizing their detrimental effects on the ecosystem.

Methods

Collection of soil samples

Soil samples were obtained from the Bhawal Sal Forest and agricultural fields in Gazipur, Bangladesh. To construct the composite sample, five different soil samples weighing a total of 250–300 g were mixed from a depth of 10–15 cm using a soil sampler. Until they were all studied, the soil samples were kept in distinct zip-lock bags with labels and maintained at 4 °C in a cold room.

Isolation of fungus

A soil suspension containing five grams of soil and 50 mL of 0.1% Tween 80 was made in a screw-cap plastic tube and incubated at room temperature for 3 h after being sieved through a 5 mm screen. Five inversions of each tube were performed at intervals of 30 min. The tubes were retained for 20 s after incubation to allow for sedimentation, and 100 µL of supernatant from each tube was plated on a Petri plate with Sabouraud dextrose agar (SDA) medium (peptone 10 g/L, agar 10 g/L, dextrose 40 g/L, and CTAB 60 mg/L). To avoid bacterial contamination, streptomycin (30 mg/L) was also added. Following inoculation, all plates underwent a two-week incubation period at 22 °C. Every 2–3 days, plates were checked for recognizable, thick, compact white mycelium development. Hypocreales-like isolates were isolated and sub-cultured.

Morphological study

Both the vegetative and reproductive structures of fungal colonies on SDA were examined using microscopy immediately after sporulation. From the outermost part of the fungal colony, little plaques were transferred to glass slides and inspected under a compound light microscope.

Sub-culture, DNA isolation, and molecular characterization

On SDA agar plates without antibiotics, the fungal isolates were sub-cultured for DNA isolation and sequencing. The procedure described by Islam1 was used to extract the DNA.

Briefly, a little lump of fungal mycelium from a 7-day-old culture was placed in an Eppendorf tube, mashed with a sterile plastic pestle, and then suspended in 1 mL of lysis buffer (400 mM Tris–HCl, pH 8.0, 60 mM EDTA, 150 mM NaCl, and 1% SDS), which was then incubated at 50 °C for 1 h in a heat block. A volume of 150 μL of precipitation buffer (5 M potassium acetate, 60.0 mL; glacial acetic acid, 11.5 mL; distilled water, 28.5 mL) was added in the tube and vortexed shortly, then incubated on ice for 5 min. The supernatant from the centrifugation was transferred to a fresh tube along with 500 mL of isopropanol to precipitate the DNA. After centrifugation at 18,000 rcf for 20 min, the DNA pellet was recovered and washed with 1 mL of 70% ethanol. After being air dried for ten minutes, the DNA pellet was dissolved in 100 µL of Tris–EDTA (TE) buffer. In a nanodrop, the DNA’s purity was examined. Polymerase chain reaction (PCR) was used to amplify the ITS region using the primers ITS1F: CTTGGTCATTTAGAGGAAGTAA and ITS4R: TCCTCCGCTTATTGATATGC in accordance with the profile: denaturation at 90 °C for 2 min, then 35 cycles of denaturation at 95 °C for 30 secs, annealing at 55 °C for 30 secs, extension at 72 °C for 1 min, and finally extension at 72 °C for 15 min1. The 5′-TEF region was amplified using EF1TF (5′-ATGGGTAAGGARGACAAGAC) and EF2TR (5′-GGAAGTACCAGTGATCATGTT) after the profile underwent an initial denaturation at 94 °C for 5 min, followed by 35 cycles at 94 °C for 40 s, 65 °C for 40 s, 72 °C for 2 min, and a final extension at 72 °C for 10 min19. The PCR product was electrophoresed in 1% agarose in 1 × TBE buffer at 120 V with GelRed nucleic acid stain and photographed with a molecular imager under UV light. For sequencing, the PCR products were sent to Macrogen, Korea.

Sequence analysis and phylogenetic tree preparation

The Sanger sequencing data of the fungal isolates were produced, and a BLAST search on the National Center for Biotechnology Information (NCBI) database was completed. The partial sequence datasets of ITS and TEF were submitted to NCBI for getting accession number. The sequences matched reference genome sequences obtained from NCBI. The Geneious V.11’s MAFT plug-in was used for multiple alignments, and the final alignment was fixed manually. Phylogenetic trees were developed by maximum likelihood analysis for the data sets using the Geneious V.11 RAxML plug-in using rapid bootstrapping and searching for the best scoring ML tree from 1000 bootstrap replicates in the GTR-GAMMA model.

Insect rearing

Eggs of S. litura were obtained from the existing culture at the Entomology Division, Bangladesh Agricultural Research Institute (BARI), Gazipur, Bangladesh. Homogenous larvae were obtained from eggs hatched on the same day. The larvae were grown in sterile plastic boxes containing pieces of okra disinfected with 0.5% (v/v) sodium hypochlorite for 10 min, maintained at 25 ± 2 °C and 65 ± 5% RH42.

Production and Collection of Beauveria conidia

Sabouraud’s Dextrose Agar (SDA) medium was used in this study. A 10 mm actively grown culture of B. bassiana was placed individually at the center of the 60 mm petri dish containing 10 mL of solid SDA media43. The inoculated plates were incubated at 28 ºC for 7 days. The conidial suspension of the isolates was then prepared by flooding the dishes with 10 mL of sterile Tween 80 (0.05%), the agar surface was gently scraped with sterile glass rods, and the suspension was collected in sterile 250 mL beakers. The suspension was then adjusted to 50 mL and mixed using a hand mixer to separate and disperse the conidia, and finally the conidial density was adjusted to 1.5 × 108 conidia per ml using a hemocytometer44. Before the bioassay experiment, conidial germination was tested on SDA agar medium.

Growth in liquid medium

A volume of 250 mL Sabouraud’s Dextrose Broth (SDB) was prepared in a 500 mL Schott bottle, and the final pH was adjusted to 6.5. The liquid broths were then inoculated with a 10 mm culture disc of the fungus. Three replications were maintained for all the B. bassiana isolates. The entire setup was kept in a shaker incubator at 25 °C temperature at 120 rpm for 10 days. White cotton ball-type growth was observed after 7 days. The mycelia were then filtered through a pre-weighed filter paper and dried in a hot air oven at 70 °C until a constant weight was obtained. This revealed the biomass production capability of all the fungal isolates 43.

Virulence of B. bassiana isolates against eggs and hatched larvae

Freshly laid egg masses that were 1–2 days old were collected and counted under a dissecting microscope. A batch of 50 eggs was separated using a hairbrush and transferred into a petri dish. A volume of 10 mL of conidial suspension (1.5 × 108 conidia/mL) was made using 0.05% Tween 80. The suspension was then sprayed over the egg masses. For control, only Tween 80 was used. Each treatment was repeated four times. 7 days after the treatment (DAT), the number of hatched and unhatched eggs was counted. The newly hatched larvae were then fed, incubated at 25 ± 2 °C, and monitored for the next 7 days. The mortality of each treatment was carefully recorded17.

Insect bioassay

Freshly laid eggs were collected and hatched to obtain homogenous larvae. The assay was conducted on 2nd instar larvae of S. litura. A set of 10 larvae in triplicate were dipped individually into a 10-mL conidial suspension of Beauveria isolates (1.5 × 108 conidia/mL) for 5 s. After treatment, transferred each set of larvae to a separate, sterile plastic box. To each box, added moist blotting paper and a piece of disinfected okra as feed. Changed the paper and feed on alternate days. At 7 DAT, the mortality of larvae was recorded according to the isolates42.

Evaluation of sublethal effects

Larvae that survived the fungal treatment were further reared until pupation at 25 ± 2 °C and 60–70% relative humidity to see the sublethal activity, such as variation in development, any kind of deformity, and longevity compared to the control. Observations were made on larval and pupal deformity, adult emergence, and any morphological deformity in various developmental stages3.

Statistical analysis

Mortality was corrected by Abbott’s formula45. The percent data were transformed by the arcsine transformation. The data were subjected to an analysis of variance (ANOVA), followed by a comparison of the means of different treatments using the least significant difference (LSD). Analyses were performed using R version 3.4.2.

Data availability

The partial sequence data of ITS and TEF genomic regions of fungal isolates during the current study are available in the NCBI repository under the Accession Numbers OP784778–OP784784 and OP785280–OP785286 (will be available on December 4 2022), respectively. The statistical datasets used and/or analyzed during the current study are available from the corresponding author upon reasonable request.

References

  1. Islam, S. M. N. Systematics, Ecology and Plant Associations of Australian Species of the Genus Metarhizium (Queensland University of Technology, 2018).Book  Google Scholar 
  2. Dhanapal, R., Kumar, D., Lakshmipathy, R., Rani, C. S. & Kumar, V. M. Isolation of indigenous strains of the white halo fungus as a biological control agent against 3rd instar larvae of tobacco caterpillar, Spodoptera litura (Fabricius) (Lepidoptera: Noctuidae). Egypt. J. Biol. Pest Control 30, 1–5 (2020). Google Scholar 
  3. Kaur, S., Kaur, H. P., Kaur, K. & Kaur, A. Effect of different concentrations of Beauveria bassiana on development and reproductive potential of Spodoptera litura (Fabricius). J. Biopest. 4, 161 (2011).CAS  Google Scholar 
  4. Mkenda, P. A. et al. Knowledge gaps among smallholder farmers hinder adoption of conservation biological control. Biocontrol Sci. Tech. 30, 256–277 (2020).Article  Google Scholar 
  5. Dhar, S., Jindal, V., Jariyal, M. & Gupta, V. Molecular characterization of new isolates of the entomopathogenic fungus Beauveria bassiana and their efficacy against the tobacco caterpillar, Spodoptera litura (Fabricius) (Lepidoptera: Noctuidae). Egypt. J. Biol. Pest Control 29, 1–9 (2019).Article  Google Scholar 
  6. Zimmermann, G. Review on safety of the entomopathogenic fungus Metarhizium anisopliae. Biocontrol Sci. Tech. 17, 879–920 (2007).Article  Google Scholar 
  7. Lacey, L. & Goettel, M. Current developments in microbial control of insect pests and prospects for the early 21st century. Entomophaga 40, 3–27 (1995).Article  Google Scholar 
  8. Kabaluk, J. T., Svircev, A. M., Goettel, M. S. & Woo, S. G. The Use and Regulation of Microbial Pesticides in Representative Jurisdictions Worldwide (International Organization for Biological Control of Noxious Animals, 2010). Google Scholar 
  9. Quesada-Moraga, E., Navas-Cortés, J. A., Maranhao, E. A., Ortiz-Urquiza, A. & Santiago-Álvarez, C. Factors affecting the occurrence and distribution of entomopathogenic fungi in natural and cultivated soils. Mycol. Res. 111, 947–966 (2007).Article  PubMed  Google Scholar 
  10. Bateman, R., Douro-Kpindou, O., Kooyman, C., Lomer, C. & Ouambama, Z. Some observations on the dose transfer of mycoinsecticide sprays to desert locusts. Crop Prot. 17, 151–158 (1998).Article  CAS  Google Scholar 
  11. Wang, Q. & Xu, L. Beauvericin, a bioactive compound produced by fungi: A short review. Molecules 17, 2367–2377 (2012).Article  CAS  PubMed  PubMed Central  Google Scholar 
  12. Imoulan, A., Hussain, M., Kirk, P. M., El Meziane, A. & Yao, Y.-J. Entomopathogenic fungus Beauveria: Host specificity, ecology and significance of morpho-molecular characterization in accurate taxonomic classification. J. Asia-Pac. Entomol. 20, 1204–1212 (2017).Article  Google Scholar 
  13. Kõljalg, U. et al. (Wiley, 2013).
  14. Rehner, S. A. et al. Phylogeny and systematics of the anamorphic, entomopathogenic genus Beauveria. Mycologia 103, 1055–1073 (2011).Article  PubMed  Google Scholar 
  15. Goble, T., Dames, J., Hill, M. & Moore, S. Investigation of native isolates of entomopathogenic fungi for the biological control of three citrus pests. Biocontrol Sci. Tech. 21, 1193–1211 (2011).Article  Google Scholar 
  16. Sain, S. K. et al. Compatibility of entomopathogenic fungi with insecticides and their efficacy for IPM of Bemisia tabaci in cotton. J. Pestic. Sci. 44, 97–105 (2019).Article  CAS  PubMed  PubMed Central  Google Scholar 
  17. Idrees, A., Afzal, A., Qadir, Z. A. & Li, J. Bioassays of Beauveria bassiana isolates against the fall armyworm, Spodoptera frugiperda. J. Fungi 8, 717 (2022).Article  Google Scholar 
  18. Glare, T. R. & Inwood, A. J. Morphological and genetic characterisation of Beauveria spp. from New Zealand. Mycol. Res. 102, 250–256 (1998).Article  Google Scholar 
  19. Bischoff, J. F., Rehner, S. A. & Humber, R. A. A multilocus phylogeny of the Metarhizium anisopliae lineage. Mycologia 101, 512–530 (2009).Article  CAS  PubMed  Google Scholar 
  20. White, T. J., Bruns, T., Lee, S. & Taylor, J. Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. PCR Protoc. 18, 315–322 (1990). Google Scholar 
  21. Heale, J. B., Isaac, J. E. & Chandler, D. Prospects for strain improvement in entomopathogenic fungi. Pestic. Sci. 26, 79–92 (1989).Article  Google Scholar 
  22. Vilgalys, R. & Gonzalez, D. Organization of ribosomal DNA in the basidiomycete Thanatephorus praticola. Curr. Genet. 18, 277–280 (1990).Article  CAS  PubMed  Google Scholar 
  23. Lutzoni, F. et al. Assembling the fungal tree of life: Progress, classification, and evolution of subcellular traits. Am. J. Bot. 91, 1446–1480 (2004).Article  PubMed  Google Scholar 
  24. Boucias, D., Pendland, J. & Latge, J. Nonspecific factors involved in attachment of entomopathogenic deuteromycetes to host insect cuticle. Appl. Environ. Microbiol. 54, 1795–1805 (1988).Article  ADS  CAS  PubMed  PubMed Central  Google Scholar 
  25. Boucias, D. G. & Pendland, J. C. The Fungal Spore and Disease Initiation in Plants and Animals 101–127 (Springer, 1991).Book  Google Scholar 
  26. Doss, R. P., Potter, S. W., Chastagner, G. A. & Christian, J. K. Adhesion of nongerminated Botrytis cinerea conidia to several substrata. Appl. Environ. Microbiol. 59, 1786–1791 (1993).Article  ADS  CAS  PubMed  PubMed Central  Google Scholar 
  27. Holder, D. J. & Keyhani, N. O. Adhesion of the entomopathogenic fungus Beauveria (Cordyceps) bassiana to substrata. Appl. Environ. Microbiol. 71, 5260–5266 (2005).Article  ADS  CAS  PubMed  PubMed Central  Google Scholar 
  28. Quesada-Moraga, E. & Alain, V. Bassiacridin, a protein toxic for locusts secreted by the entomopathogenic fungus Beauveria bassiana. Mycol. Res. 108, 441–452 (2004).Article  CAS  PubMed  Google Scholar 
  29. Faria, M., Lopes, R. B., Souza, D. A. & Wraight, S. P. Conidial vigor vs. viability as predictors of virulence of entomopathogenic fungi. J. Invertebr. Pathol. 125, 68–72 (2015).Article  PubMed  Google Scholar 
  30. Petrisor, C. & Stoian, G. The role of hydrolytic enzymes produced by entomopathogenic fungi in pathogenesis of insects mini review. Roman. J. Plant Prot. 10, 66–72 (2017). Google Scholar 
  31. Tseng, M.-N., Chung, C.-L. & Tzean, S.-S. Mechanisms relevant to the enhanced virulence of a dihydroxynaphthalene-melanin metabolically engineered entomopathogen. PLoS ONE 9, e90473 (2014).Article  ADS  PubMed  PubMed Central  Google Scholar 
  32. Cheong, P., Glare, T. R., Rostás, M. & Haines, S. R. Microbial-Based Biopesticides 177–189 (Springer, 2016).Book  Google Scholar 
  33. Tillman, P. Parasitism and predation of stink bug (Heteroptera: Pentatomidae) eggs in Georgia corn fields. Environ. Entomol. 39, 1184–1194 (2010).Article  CAS  PubMed  Google Scholar 
  34. Kellner, R. L. The role of microorganisms for eggs and progeny. in Chemoecology of insect eggs and egg deposition, 149–164 (2002).
  35. Cruz-Avalos, A. M., Bivián-Hernández, M. D. L. Á., Ibarra, J. E. & Del Rincón-Castro, M. C. High virulence of Mexican entomopathogenic fungi against fall armyworm, (Lepidoptera: Noctuidae). J. Econ. Entomol. 112, 99–107 (2019).Article  CAS  PubMed  Google Scholar 
  36. Idrees, A. et al. Effectiveness of entomopathogenic fungi on immature stages and feeding performance of Fall Armyworm, Spodoptera frugiperda (Lepidoptera: Noctuidae) Larvae. Insects 12, 1044 (2021).Article  PubMed  PubMed Central  Google Scholar 
  37. Khorrami, F., Mehrkhou, F., Mahmoudian, M. & Ghosta, Y. Pathogenicity of three different entomopathogenic fungi, Metarhizium anisopliae IRAN 2252, Nomuraea rileyi IRAN 1020C and Paecilomyces tenuipes IRAN 1026C against the potato tuber moth, Phthorimaea operculella Zeller (Lepidoptera: Gelechiidae). Potato Res. 61, 297–308 (2018).Article  Google Scholar 
  38. Shweta, A. & Simon, S. Efficacy of Beuveria bassiana on different larval instars of tobacco caterpillar (Spodoptera litura Fab.). Int. J. Curr. Microbiol. Appl. Sci. 6, 1992–1996. https://doi.org/10.20546/ijcmas.2017.608.237 (2017).Article  CAS  Google Scholar 
  39. Ahmad, S. Enzymatic adaptations of herbivorous insects and mites to phytochemicals. J. Chem. Ecol. 12, 533–560 (1986).Article  CAS  PubMed  Google Scholar 
  40. Mullin, C. A. Adaptive relationships of epoxide hydrolase in herbivorous arthropods. J. Chem. Ecol. 14, 1867–1888 (1988).Article  CAS  PubMed  Google Scholar 
  41. Torrado-León, E., Montoya-Lerma, J. & Valencia-Pizo, E. Sublethal effects of Beauveria bassiana (Balsamo) Vuillemin (Deuteromycotina: Hyphomycetes) on the whitefly Bemisia tabaci (Gennadius) (Hemiptera: Aleyrodidae) under laboratory conditions. Mycopathologia 162, 411–419 (2006).Article  PubMed  Google Scholar 
  42. Tupe, S. G., Pathan, E. K. & Deshpande, M. V. Development of Metarhizium anisopliae as a mycoinsecticide: From isolation to field performance. JoVE 125, e55272 (2017). Google Scholar 
  43. Senthamizhlselvan, P., Sujeetha, J. A. R. & Jeyalakshmi, C. Growth, sporulation and biomass production of native entomopathogenic fungal isolates on a suitable medium. J. Biopest. 3, 466 (2010). Google Scholar 
  44. Zhang, S., Gan, Y., Xu, B. & Xue, Y. The parasitic and lethal effects of Trichoderma longibrachiatum against Heterodera avenae. Biol. Control 72, 1–8 (2014).Article  Google Scholar 
  45. Abbott, W. S. A method of computing the effectiveness of an insecticide. J. Econ. Entomol 18, 265–267 (1925).Article  CAS  Google Scholar 

Download references

Acknowledgements

This research was funded by the Bangladesh Academy of Science under BAS-USDA Endowment program (4th Phase BAS-USDA BSMRAU CR-13). The authors also expressed thanks to Entomology Division, Bangladesh Agricultural Research Institute (BARI), Gazipur, Bangladesh for proving supports for egg collection and rearing.

Author information

Authors and Affiliations

  1. Institute of Biotechnology and Genetic Engineering, Bangabandhu Sheikh Mujibur Rahman Agricultural University, Gazipur, BangladeshShah Mohammad Naimul Islam, Md. Zahid Hasan Chowdhury, Mahjabin Ferdaous Mim & Tofazzal Islam
  2. Cotton Research Training and Seed Multiplication Farm, Gazipur, BangladeshMilia Bente Momtaz

Contributions

S.M.N.I. conceptualized the idea, supervised experiments, wrote and edited the manuscript. M.Z.H.C. designed experiments, analyzed data and wrote the manuscript. M.F.M. performed fungal and molecular study, M.B.M. conducted insect bioassay, T.I. contributed in interpretation, reviewed and edited the manuscript. Correspondence and requests for materials should be addressed to S.M.N.I. or T.I.

Corresponding authors

Correspondence to Shah Mohammad Naimul Islam or Tofazzal Islam.

Ethics declarations

Competing interests

The authors declare no competing interests.

Additional information

Publisher’s note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Rights and permissions

Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article’s Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/.

Reprints and Permissions

About this article

Cite this article

Islam, S.M.N., Chowdhury, M.Z.H., Mim, M.F. et al. Biocontrol potential of native isolates of Beauveria bassiana against cotton leafworm Spodoptera litura (Fabricius). Sci Rep 13, 8331 (2023). https://doi.org/10.1038/s41598-023-35415-x

Download citation

  • Received29 November 2022
  • Accepted17 May 2023
  • Published23 May 2023
  • DOIhttps://doi.org/10.1038/s41598-023-35415-x

Share this article

Anyone you share the following link with will be able to read this content:

Provided by the Springer Nature SharedIt content-sharing initiative

Subjects

Download PDF

Scientific Reports (Sci Rep) ISSN 2045-2322 (online)

Posted in Biological control, Insects | Leave a Comment »

Australia: A new technique reduces mouse damage to crops even during plagues.

May 27, 2023 by IAPPS

A new technique reduces mouse damage to crops even during plagues

Mice are tricked to think there is no point digging for seeds.

May 24, 2023

ByVidya Nagalwade

Image showing wheat crops.
Credit: Pixabay

The technology developed by researchers at the University of Sydney could revolutionize agricultural loss management due to mouse plague.

In 2021, NSW Farmers predicted that the mouse plague would inflict $1 billion in crop loss in Australia.

 The study, published in Nature Sustainability, was led by Ph.D. student Finn Parker, with co-authors from the Sydney Institute of Agriculture and School of Life and Environmental Sciences, Professor Peter Banks, Dr. Catherine Price, and Jenna Bytheway. 

According to the research team, spraying diluted wheat germ oil on a wheat crop before and after seeding reduces mice’s ability to successfully steal wheat seeds by 63 percent compared to untreated controls.

Seed loss was decreased by 74 percent if the same solution was applied to the wheat plot before planting. They claim that the mice have figured out how to ignore the wheat odour by the time the crop is sown. 

This disinformation strategy may be effective in other agricultural systems since any animal that uses smell to locate food is potentially subject to our capacity to manipulate that smell and impair the animal’s ability to search.

Professor Banks said, “We could reduce mice damage even during plague conditions simply by making it hard for mice to find their food, by camouflaging the seed odor. Because they’re hungry, they can’t spend all their time searching for food that’s hard to find.” 

He also said, “When the smell of the seed is everywhere, they’ll just go and look for something else instead of being encouraged to dig. That’s because mice are precise foragers that can smell seeds in the ground and explore exactly where a seed is. However, they can’t do that because everything smells like seeds. This misinformation tactic could work well in other crop systems. Indeed, any animal that finds food by smell is potentially vulnerable to us manipulating that smell and undermining their ability to search.”

Finn Parker said, “The camouflage appeared to last until after the seeds germinated, which is the period of vulnerability when wheat needs to be protected.”

He added that camouflage treatment could be an effective solution for wheat growers, given wheat’s brief vulnerability. 

He said, “Most mouse damage occurs when seeds are sown up to germination, just under two weeks later. Mice can’t evolve resistance to the method either because it uses the same odor that mice rely on to find wheat seeds.”

The majority of mouse damage happens between the time seeds are sown and germination or slightly under two weeks later.

 In May 2021, 60 plots on a farm 10 kilometers northwest of Pleasant Hills, New South Wales, served as the testing ground for five treatments.

The other three treatments were controls, while two used the wheat germ oil solution. 

Similar results were achieved by all control treatments, which sustained noticeably more significant damage than treated plots.

A reasonably affordable by-product of milling is wheat germ oil. The scientists claimed that their solution, consisting of diluted wheat germ oil in water, provides a safe, long-lasting substitute for pesticides and baits.

“If people want to control mice but can’t get numbers down low enough, our technique can be a potent alternative to pesticides or add value to existing methods.” Dr Price said.

The research could aid wheat farmers at a crucial time.

The number of mice is increasing, and wheat is sown in the middle of fall.

According to the Department of Agriculture, the Australian wheat market is anticipated to hit a record high of $15 billion this fiscal year.

Wheat producers may benefit from the research at this critical time. Wheat is sown in the middle of fall, and mouse populations are increasing.

The next step is for the researchers to determine how diluted the concentration can be and still effectively repel mice and how frequently the solution needs to be sprayed on a crop to maintain its efficacy.

According to the Department of Agriculture, the Australian wheat market is anticipated to hit a record high of $15 billion this fiscal year. 

Journal Reference:

  1. Parker, F.C.G., Price, C.J., Bytheway, J.P., et al. Olfactory misinformation reduces wheat seed loss caused by rodent pests. Nature Sustainability. DOI: 10.1038/s41893-023-01127-3

Posted in Pest damage, Vertebrates | Leave a Comment »

Australia: A game changing weed killer for farmers

May 27, 2023 by IAPPS

University of Adelaide

Failed antibiotic now a game changing weed killer for farmers

23-May-2023 10:05 PM EDT, by University of Adelaide

favorite_border

Newswise: Failed antibiotic now a game changing weed killer for farmers

(From left) Emily Mackie, Dr Andrew Barrow and Dr Tatiana Soares da Costa.

Newswise — Weed killers of the future could soon be based on failed antibiotics.

A molecule which was initially developed to treat tuberculosis but failed to progress out of the lab as an antibiotic is now showing promise as a powerful foe for weeds that invade our gardens and cost farmers billions of dollars each year.

While the failed antibiotic wasn’t fit for its original purpose, scientists at the University of Adelaide discovered that by tweaking its structure, the molecule became effective at killing two of the most problematic weeds in Australia, annual ryegrass and wild radish, without harming bacterial and human cells.

“This discovery is a potential game changer for the agricultural industry. Many weeds are now resistant to the existing herbicides on the market, costing farmers billions of dollars each year,” said lead researcher Dr Tatiana Soares da Costa from the University of Adelaide’s Waite Research Institute.

“Using failed antibiotics as herbicides provides a short-cut for faster development of new, more effective weed killers that target damaging and invasive weeds that farmers find hard to control.”

Researchers at the University’s Herbicide and Antibiotic Innovation Lab discovered there were similarities between bacterial superbugs and weeds at a molecular level.

They exploited these similarities and, by chemically modifying the structure of a failed antibiotic, they were able to block the production of amino acid lysine, which is essential for weed growth.

“There are no commercially available herbicides on the market that work in this way. In fact, in the past 40 years, there have been hardly any new herbicides with new mechanisms of action that have entered the market,” said Dr Andrew Barrow, a postdoctoral researcher in Dr Soares da Costa’s team at the University of Adelaide’s Waite Research Institute.

It’s estimated that weeds cost the Australian agriculture industry more than $5 billion each year.

Annual ryegrass in particular is one of the most serious and costly weeds in southern Australia.

“The short-cut strategy saves valuable time and resources, and therefore could expedite the commercialisation of much needed new herbicides,” said Dr Soares da Costa.

“It’s also important to note that using failed antibiotics won’t drive antibiotic resistance because the herbicidal molecules we discovered don’t kill bacteria. They specifically target weeds, with no effects on human cells,” she said.

It’s not just farmers who could reap the benefits of this discovery. Researchers say it could also lead to the development of new weed killers to target pesky weeds growing in our backyards and driveways.

“Our re-purposing approach has the potential to discover herbicides with broad applications that can kill a variety of weeds,” said Dr Barrow.

This research has been published in the journal of Communications Biology.

Dr Tatiana Soares da Costa and her team are now looking at discovering more herbicidal molecules by re-purposing other failed antibiotics and partnering up with industry to introduce new and safe herbicides to the market.

Funding for this research was provided by the Australian Research Council through a DECRA Fellowship and a Discovery Project awarded to Dr Tatiana Soares da Costa.

The first author on the paper is Emily Mackie, a PhD student in Dr Soares da Costa’s team, who is supported by scholarships from the Grains and Research Development Corporation and Research Training Program. Co-authors include Dr Andrew Barrow, Dr Marie-Claire Giel, Dr Anthony Gendall and Dr Santosh Panjikar.

The Waite Research Institute stimulates and supports research and innovation across the University of Adelaide and its partners that builds capacity for Australia’s agriculture, food, and wine sectors.

MEDIA CONTACT
CITATIONS

Communications Biology

TYPE OF ARTICLE

Research Results

SECTION

SCIENCE

CHANNELS

AgricultureAll Journal NewsPharmaceuticals

COMMENTS | COMMENTING POLICY

Posted in herbicide resistance, Herbicides, Weeds | Leave a Comment »

Australia: GM Fruit Claimed To Resist Panama Disease

May 27, 2023 by IAPPS

Banana Safety Net: Australian GM Fruit Claimed To Resist Panama Disease

May 21, 2023

Olga

Scientists from Australia’s Queensland University of Technology have submitted the results of their research — a genetically modified Cavendish banana — to regulators for approval, claiming that the fruit could serve as a safety net for the industry, which is suffering from the continued spread of the destructive Panama disease fungus, also known as Fusarium wilt.

The banana variety, known as QCAV-4, has been genetically modified to be resistant to Panama disease tropical race 4, which currently poses a grave threat to the global banana supply. The TR4 strain has had a severe impact on production throughout Southeast Asia, causing the Philippines, one of the world’s leading banana exporters, to slip from second to third place in last year’s global export rankings.

If authorized by regulators, QCAV-4 would become the first genetically modified fruit permitted for cultivation and consumption in Australia, as well as the world’s first approved genetically modified banana variety. However, even if the fruit is given a green light, the research team does not plan to immediately release it for commercial production or consumption. According to professor James Dale, who led the research on QCAV-4, the variety provides a potential remedy for growers in the event that Panama disease wipes out the Australian banana sector.

Cavendish bananas gained popularity after plantations of the previously dominant variety, Gros Michel, were ravaged by the Panama TR1 outbreak in the 1950s, and they now account for approximately half of commercial banana production globally. The TR4 strain, which emerged in Taiwan in the 1990s and quickly spread to China, Indonesia, Malaysia, the Philippines and even northern Australia, is now threatening the Cavendish cultivar, which was previously thought to be resistant to Fusarium wilt. The TR4 strain was also detected in Colombia in 2019, Peru in 2021 and Venezuela in 2023, raising fears about the potential eradication of much of the world’s banana crop, given that Latin America and the Caribbean dominate the global supply. In 2022, approximately 77% of the world’s banana exports originated from Latin America and the Caribbean, followed by 20% from Asia and the remainder from Africa.

QCAV-4 was engineered over 20 years of research by introducing a resistance gene from a wild banana that is immune to TR4 into the Cavendish. “We did a much, much bigger field trial that we planted in 2018, and that’s still going,” Dale said. After four years of trials, the QCAV-4 variety had a 2% infection rate, compared with rates of 95% and 75% in two lots of regular Cavendish plants. “If the disease gets going [in Australia] like it has in the Philippines … we’ve got this banana in the back pocket and we’ll be able to pull it out,” he noted.

In the opinion of Australia’s Office of the Gene Technology Regulator, the recent achievement represents a significant milestone; nonetheless, there are still many steps to be taken. A spokesperson for the regulator stated that “the gene technology regulator will carefully examine any risks to people and the environment posed by the commercial cultivation of the GM banana plants,” adding that a permit to grow GM bananas would only be granted if there is assurance that any risks that arise can be managed effectively. In addition to two stakeholder consultation sessions, there will also be a public consultation, which is scheduled to take place in August.

The approval of genetically modified bananas is subject to fruit and environmental safety assessments conducted by the authorities. Another question is whether the approved fruit will gain the trust of consumers. Previously, when Dale’s trials were underway, industry insiders offered a variety of opinions. Some voiced concern that genetically modified bananas would not be accepted on the market. Opponents of genetically modified fruit also urged seeking out traditionally bred alternatives, including cultivars other than Cavendish, some of which are regarded to be even more nutritious and taste better.

Image: iStock

Topics: 

Food Safety

Policy

Production

Regions: 

Global

Australia

Produce: 

Bananas

Posted in Emerging/invasive pests, Fungi | Leave a Comment »

UK: The threat of Xylella fastidiosa to the horticultural industry

May 26, 2023 by IAPPS

Grahame Jackson

PestNet

Sydney NSW, Australia

For your information

From pests to pathogens: how healthy is your horticulture?

Financial Times

National Plant Health Week aims to educate people about keeping local plantlife safe from potentially devastating disease

Whisper the words Xylella fastidiosa and the British horticultural industry will break out into a collective sweat. Xylella is a fast-spreading bacterium that has wiped out olive groves in Italy and is attacking swaths of fruit and ornamental plants across western Europe. Its range of more than 650 host plants includes trees such as oak, elm, olive and plane, and a long list of garden favourites including lavender, rosemary, hebe and jasmine. It is not yet in the UK, but it if does sneak in it could be devastating, says Raoul Curtis-Machin, director of horticulture at the Royal Botanic Garden Edinburgh (RBGE). An outbreak of Xylella fastidiosa “could lead to teams descending on gardens to rip out and burn many different plants in all the gardens within 100m of the outbreak,” he says. “This disease could have a massive impact on the British landscape.”  

Posted in Bacteria, Emerging/invasive pests | Leave a Comment »

‘New artificial intelligence algorithm for more accurate plant disease detection ‘

May 26, 2023 by IAPPS

Tuesday, 16 May 2023 18:14:00

PestNet

Grahame Jackson posted a new submission ‘New artificial intelligence algorithm for more accurate plant disease detection ‘

Submission

New artificial intelligence algorithm for more accurate plant disease detection

Phys.Org

by NanJing Agricultural University
AlgorithmEvery year, plant diseases caused by bacteria, viruses, and fungi contribute to major economic losses. The prompt detection of these diseases is necessary to curb their spread and mitigate agricultural damage, but represents a major challenge, especially in areas of high-scale production. Smart agriculture systems use camera surveillance equipped with artificial intelligence (AI) models to detect features of plant diseases, which often manifest as changes in leaf morphology and appearance.

However, conventional methods of image classification and pattern recognition extract features indicative of diseased plants from a training set. As a result, they have low interpretability, which means it is challenging to describe what features were learned.

Further, obtaining large datasets for model training is tedious. Handcrafted features, which are selected based on expert-designed feature detectors, descriptors, and vocabulary, offer a feasible solution to this problem. However, these often result in the adoption of irrelevant features, which reduce algorithm performance.

Read on: https://phys.org/news/2023-05-artificial-intelligence-algorithm-accurate-disease.html

Posted in Diagnostics, Digital tools | Leave a Comment »

Plant science’s biggest problems

May 26, 2023 by IAPPS

May 20, 2023 – Science

Plant science’s biggest problems

Alison Snyder
Illustration of a microscope with a flower extending from the eyepiece and tube
Illustration: Natalie Peeples/Axios

Plant scientists are increasingly concerned about how plants will fare as climates change across the planet — and what role plants themselves can take in addressing one of the world’s most pressing problems.

Driving the news: A recent survey takes the pulse of the plant science community — a group of researchers whose subjects are often overlooked but critically support life on Earth.

  • An international panel of 15 researchers from five continents analyzed more than 600 questions collected from plant scientists, horticulturalists, gardeners, other experts and “botanically curious non-experts.”
  • They identified 100 pressing questions facing plant science, ranging from how plant scientists can collaborate with city designers and how plants can be grown in space to fundamental questions about plant pathogens and the genomes and evolution of plants.
  • More than 20% of the questions focused on climate change: how it will affect plant diseases and where plants can grow, as well as whether farming seaweed and other crops under the sea could reduce the impact of climate change, among other topics.

Flashback: When a similar survey was done in 2011 the questions focused more on what could be learned from plants.

  • “This time around the questions were more about, ‘what do we do to save them?'” says Emily May Armstrong, an interdisciplinary plant researcher and co-author of the study that appeared in New Phytologist.
  • There were also questions focused on determining which plants can best help the capture of carbon in soil, how plants can mitigate flooding, and how microbiomes can be leveraged to develop plants that can help to mitigate the effects of climate change.

What’s happening: Plant scientists are studying a range of climate-related topics. These include:

  • Seagrass as a way to capture and store carbon. A key question is what traits give these plants the ability to efficiently remove carbon.
  • Sequestering carbon in other plants — trees and crops.
  • Increasing the efficiency of photosynthesis and developing climate-resilient crops
  • Plants — such as switchgrass and black cottonwood — as a source of biofuel

What they’re saying: Climate change is “an enormous obstacle that will require a multidisciplinary approach. It affects molecular, physiological, ecological and all levels of plant growth and the plant life cycle,” says Marie Klein, a Ph.D. candidate at the University of California, Davis, who organized the “Plants in the Climate Crisis” symposium held last week at the university.

https://ce4c8b225ba31c32202c61bb80ff71b5.safeframe.googlesyndication.com/safeframe/1-0-40/html/container.html

What to watch: The survey organizers say the questions highlighted the importance of including scientists worldwide, insights from non-experts, and the need for more funding.

  • “This time they heard the voice of the Global South,” says Shyam Phartyal, a seed ecologist at Nalanda University in Rajgir, India, and co-author of the paper.
  • Plant sciences continue to struggle with biases: A recent study of more than 300,000 scientific articles published in the field over the past 20 years found “authors in Northern America arecited nearlytwice as many times as authors based in Sub-Saharan Africa and Latin America, despite publishing in journals with similar impact factors,” Rose Marks of Michigan State University and her colleagues wrote earlier this year in the journal PNAS.
  • They also found gender imbalances that tip to male authors and that most studies “focus on economically important crop and model species, and a wealth of biodiversity is underrepresented in the literature.”

https://ce4c8b225ba31c32202c61bb80ff71b5.safeframe.googlesyndication.com/safeframe/1-0-40/html/container.html

Posted in Climate change, Plant Pathogens | Leave a Comment »

Montana, USA: Research into wheat stem sawfly biocontrol.

May 26, 2023 by IAPPS

Montana State alumna publishes research into wheat stem sawfly biocontrols

Reagan Colyer, MSU News Service
May 19, 2023

BOZEMAN – Research from a Montana State University alumna published recently in the journal Physiological Entomology could have tangible impact for Montana agricultural producers who deal with perennial damage from wheat stem sawflies. 

Laissa Cavallini, who completed her master’s degree in entomology in spring 2022, worked alongside professor David Weaver and department head Bob Peterson in the Department of Land Resources and Environmental Sciences in MSU’s College of Agriculture. The project examined two species of parasitic wasps that act as biocontrols for wheat stem sawfly. Cavallini explored the nutritional needs of those wasps to explore ways of boosting their effectiveness as biocontrols — a pest management tactic that involves using one organism to manage another.

The insects, called Bracon cephi and Bracon lissogaster, are small orange wasps that can detect the presence of wheat stem sawfly larvae inside a wheat stem. They then inject a paralyzing toxin into the sawfly larvae before laying their own eggs. When the wasp eggs hatch, the immature wasps kill and consume the immobilized sawfly.

B. lissogaster, a small wasp species that acts as a natural biocontrol to wheat stem sawfly, was the subject of a recent publication by MSU alumna Laissa Cavallini. Photo by Robert Peterson.

“Something interesting about these parasitoids and about wheat stem sawfly itself is that the organisms are all native,” said Cavallini, who completed her undergraduate work in her home country of Brazil before joining Weaver’s lab in 2018 as a graduate student. “What’s more, these two species are the only ones known to parasitize the wheat stem sawfly.”

That unique relationship means that B. cephi and B. lissogaster are naturally suited to act as biocontrols for wheat stem sawflies but are limited by a short lifespan in wheat fields. Cavallini’s work examined the nutritional needs of the parasitic wasps to see if their diet could increase their lifespan and potentially make them more effective management tools.

“I thought it was a nice opportunity to work with parasitoids and look into controlling insect pests in a way that’s less harmful to the environment,” said Cavallini. “We already knew that some parasitoids were able to feed on nectar, but we didn’t have a lot of information in the beginning. We saw an opportunity to see if that was the same here in Montana.”

Because Montana has a dry, arid climate, Cavallini said, it was necessary to identify whether the wasps could readily access plant nectar as a food and water source. Depending on the type of plant, a lack of water could mean the nectar forms crystals that are difficult to consume or, most often, the nectar is stored in a part of the plant that the small insects can’t easily reach. Cavallini built on research done by a previous graduate student, Dayane Reis, to determine whether ingesting sugar had an impact on the wasps’ lifespan. The insects were fed sucrose, the same type of sugar that they would get from plant nectar.

“We noticed that sugars helped them a lot,” Cavallini said. “They need this resource. Feeding on water, they would live for two to five days, and feeding on sugar, some of them lived for 60 days or longer.”

It was an important finding, Cavallini said, and it confirmed the hypothesis that nectar could make a large difference in the effectiveness of the parasitoids as biocontrols. But the team still had to gauge whether the wasps could access plant nectar on or near agricultural fields, so they next investigated whether the lab findings could be replicated in an agricultural setting and explored crops that could serve as a source of nectar.

Cowpea, a pulse crop that produces extrafloral nectar, could be a viable food source for two species of wasps that act as natural biocontrols for wheat stem sawflies.

Ultimately, the team identified cowpea as a potential partner crop to serve as a food source for the two parasitoid species. A type of pulse crop, cowpea was appealing for several reasons. It produces extrafloral nectar, meaning its nectar is more easily accessible for insects like B. cephi and B. lissogaster, providing an ideal food source to help them live longer and work more effectively in wheat stem sawfly management. Additionally, heat and drought tolerant cowpea also provides many of the same benefits as other pulse crops, like peas and lentils. It fixes nitrogen in soil, reducing the need for nitrogen fertilizer, and it helps to prevent erosion and maintain soil moisture, making it a good candidate as a rotational crop in years when a field may otherwise be left fallow, said Cavallini. 

“Another important part of this research is that we don’t have cowpea being widely grown in Montana,” she said. “We didn’t know if the parasitoids, which are native, would be attracted to it. But we found that they were able to perceive odors from cowpea plants and move to feed on the extrafloral nectar.”

Because the experiments with cowpea were done in a lab, Cavallini said field tests are needed to determine if those results can be replicated on a farm. She added that incorporating this biocontrol could be effective alongside the development of solid-stemmed wheat varieties that are more difficult for sawflies to burrow into. As Cavallini moves on to a doctoral program at North Carolina State University, she hopes future graduate students at MSU will continue those explorations.

“Altogether, this research has the potential to have important impacts on how wheat stem sawfly is managed in Montana,” Cavallini said.

David Weaver, Department of Land Resources and Environmental Sciences, weaver@montana.edu or 406-994-7608

Republishing

You may republish MSU News Service articles for free, online or in print. Questions? Contact us at msunews@montana.edu or 406-994-4565.

High-Resolution Images

For high-resolution promotional images visit the pressroom

Posted in Biological control | Leave a Comment »

Is the EU ready to join the global gene editing revolution?

May 26, 2023 by IAPPS

Is the EU ready to join the global gene editing revolution?

​

Dr Petra Jorasch

​

May 2023

Science for Sustainable Agriculture

Facebook
Twitter
LinkedIn

Regulatory authorities around world are moving rapidly to clarify their stance on new plant breeding technologies such as gene editing. Nearly all are determining that certain gene edited crops should be regulated in the same way as conventionally bred crops, rather than as GMOs. As the European Commission prepares to unveil its plans for the future regulation of these techniques, is the EU ready to join the global gene editing revolution, or will we remain locked in a political and regulatory time warp, asks Dr Petra Jorasch.

Major new developments in gene editing are now taking place with increasing frequency, as the world looks to harness the potential of genetic innovation to tackle urgent global challenges of food security, improved nutrition, climate change and pressure on finite natural resources of land, energy and water.

Just in the past couple of months, for example, the Canadian Government confirmed that gene edited crops without foreign genes will be regulated in the same way as conventionally bred varieties, and the UK Parliament approved new legislation in England which removes gene edited, or ‘precision bred’, plants and animals from the scope of restrictive GMO rules. In doing so, they joined a growing list of countries around the world seeking to encourage the use of these more precise breeding methods, including the United States, Japan, Australia, Argentina and Brazil.   

Over the same period, the Chinese Government approved its first gene edited food crop, a soybean high in healthy oleic acid, the Philippines approved a gene edited ‘non-browning’ banana designed to reduce food waste, and the US authorities cleared a new type of mustard greens, gene edited for reduced bitterness and improved flavour.

Here in Europe, we continue to see major research breakthroughs in these technologies, including the recent announcement that researchers at Wageningen University in the Netherlands have used CRISPR/Cas gene editing technology to make potato plants resistant to late blight disease caused by Phytophthora infestans without inserting foreign DNA in the potato genome. It is hard to overstate the potential significance of this breakthrough, not only in safeguarding harvests from a devastating fungal infection, but also in reducing the need for pesticide sprays.       

As the pace of these exciting developments accelerates around the world, a key question set to be answered over the coming months is whether Europe will join in, or remain locked out?

The European Commission is preparing to publish its long-awaited proposal for future regulation of the products of new genomic techniques (NGT), which are currently classified as GMOs in line with a European Court ruling dating back to July 2018.

In a study following this ruling the Commission concluded that the EU’s 20-year-old GMO rules are ‘not fit for purpose’ to regulate these new breeding methods, largely because those regulations were put in place years before gene editing technologies were even dreamt of.

But will the Commission’s proposal follow other countries in determining that NGT plant products which could have occurred naturally or been produced by conventional means should be regulated in the same way as their conventionally bred counterparts? Or will it succumb to the anti-science lobby, imposing GMO-style traceability, labelling and coexistence obligations for these conventional-like NGTs, which will not only deter innovation and cement the EU’s future as a museum of agriculture, but also risk trade-related challenges as gene editing becomes one of the default delivery models for global crop genetic improvement?

Earlier this month, 20 European value chain organisations, including Euroseeds, signed a joint open letter urging the Commission to treat conventional-like NGT plants  in the same manner as their conventionally bred counterparts to avoid regulatory discrimination of similar products.

In the letter, all 20 organisations – representing EU farming, food and feed processing, plant breeding, scientific research and input supply organisations – underlined their commitment to transparency and information sharing to support customer and consumer choice.

Following the recent example of Canada, which has introduced a registry for gene edited plant varieties to ensure transparency and choice, the joint letter points out that national variety lists and the European Common Catalogue could be used to provide freedom of choice to farmers and growers, and allow value chains wishing to avoid the use of conventional-like NGT plants in their production to do so. Already today, for example, some private organic certification schemes exclude plant varieties bred using certain exempted methods of genetic modification such as cytoplast fusion. These private standards are observed, and the respective value chains co-exist, without the need for a specific regulatory framework, but through varietal information provided by the seed sector.

However, transparency does not necessarily imply a requirement for traceability (and/or labelling). Transparency stands at the beginning of value chains and, as such, does not disrupt food chain operations and product flows but provides freedom of choice for farmers and growers. A requirement for mandatory labelling of one particular breeding method would not only incur additional costs within the supply chain, but could also erroneously be perceived by some consumers as a warning statement and so discriminate unfairly against conventional-like NGT products. This in turn could prevent the potential of NGT plants to contribute to sustainable agricultural production and food security from being realised.

Where NGT plant products could equally have been produced using other conventional breeding methods (which are not subject to a mandatory labelling requirement), it would also constitute a breach of the fundamental principles of non-discrimination of like-products and factual information under General Food Law.

The joint value chain letter also highlighted the challenges of detection and identification of NGT plant products for market control and enforcement purposes. Since it is not technically possible to distinguish how the genetic change in a conventional-like NGT plant occurred (because it is conventional-like!), it is highly unlikely that laboratory tests would ever be able to detect and identify the presence of NGT-derived plant products in food or feed entering the EU market, creating enforcement issues and legal uncertainty for operators. The EU regulatory system risks losing trust if it is unenforceable and, with this, becomes vulnerable to fraud.   

Any mandatory traceability or segregation requirements (eg paper trail systems) for technically similar products would bring significant costs and logistical burdens for operators, which are not aligned with current food trade and processing operations, and as such would represent a further, unjustified barrier to the adoption of NGT plants in the EU.

Finally, in relation to the coexistence of farming systems and international trade, the joint letter points out that, today, EU regulations do not impose coexistence measures between conventional and organic farming, even though some organic farming standards already exclude plant varieties from certain non-regulated-GMO breeding methods. Similarly, the US, with which the EU has agreed equivalency schemes for organic food, does not impose specific coexistence measures between organic and conventional farmers (including for conventional-like NGT products). This has the obvious advantage for US organic growers and food producers that such food will also be accepted as organic in the EU. In sharp contrast, always imposing risk assessment and traceability plus labelling requirements (as well as coexistence measures) for conventional-like NGT plants and products would be incompatible with organic standards in third countries like the US. This would endanger well-established equivalency standards and international organic value chains.

In short, imposing traceability and labelling requirements, and coexistence measures that place specific obligations on farmers growing conventional-like NGT varieties, would have negative implications for the competitiveness of the EU agri-food value chain as well as the enforceability of regulations.

It would also be at odds with the EU’s guiding regulatory principles of practicality, proportionality and non-discrimination.  

Our policy-makers have a unique opportunity to embrace and enable the use of these more precise breeding technologies in European agriculture, and to improve prospects for delivering the sustainability objectives set out in the EU’s Green Deal.

Is the EU ready to join the global gene editing revolution, or will we remain locked in a political and regulatory time warp?

Petra Jorasch holds a PhD in plant molecular biology from the University of Hamburg. She is an internationally recognised science, communication and industry advocacy expert with more than 20 years of experience in and a deep knowledge of the relevant policy frameworks for seeds, plant science and breeding, access and use of plant genetic resources as well as relevant intellectual property protection systems. Petra worked for 13 years in the German seed sector at the interface of science and industry, managing intellectual property rights, public-private partnerships and technology transfer. From 2014-2017 she was Vice Secretary General of the German Plant Breeders’ Association (BDP) and its research branch GFPi (German Federation for Plant innovation). Petra joined Euroseeds in February 2017 as the spokesperson of the EU plant breeding sector on modern plant breeding methods and innovative technologies.

Social Media: LinkedIn: https://www.linkedin.com/in/petra-jorasch-57120a56/ 

Twitter: @pjorasch

Contact us

Posted in Biotechnology, Gene editing, GMOs | Leave a Comment »

Online webinar on the topic ‘Improving knowledge, skills and capacity building to ensure plant health in more sustainable agricultural systems’.

May 26, 2023 by IAPPS

Dear Colleagues,

In the context of this year’s EU Green Week, Plants for the Future ETP and Euphresco are co-organising an online webinar on the topic ‘Improving knowledge, skills and capacity building to ensure plant health in more sustainable agricultural systems’. The event will be broadcast on 5th June 2023 from 14 to 15:30 CEST. The focus will be on low- hazard plant protection products, what they are and what challenges they face in terms of regulation and utilisation. Please find attached the agenda and abstract of the event as well as the registration link. You can also register directly here.

Speakers will include

Domenico Deserio (EU Commission DG SANTE Unit on Pesticides and Biocides)

Patrice Marchand (Technical Institute for Organic Agriculture)

Gianfranco Romanazzi (Marche Polytechnic University)

Neil Audsley (Fera Science Ltd)

Christoph Grondal (Eurofins Agroscience Services)

Do not hesitate to share the information around you.

Best regards

Baldissera

Baldissera GIOVANI, PhD

Euphresco Co-ordinator at EPPO

21 boulevard Richard Lenoir

75011 Paris, FRANCE

Telephone: +33 (0)1 84 79 07 54

Fax : +33 (0)1 70 76 65 47

Email : bgiovani@euphresco.net; bg@eppo.int

Posted in Meetings, Plant health, Sustainability | Leave a Comment »

New Zealand: Warming climate could deliver new crops, and blights.

May 26, 2023 by IAPPS

May 5, 2023

Editors’ notes

Report: Warming climate could deliver new crops, and blights, to New Zealand

by Better Border Biosecurity (B3) Credit: Pixabay/CC0 Public Domain

New, invasive plant-destroying insects, weeds and diseases will increasingly challenge New Zealand’s borders as a warming climate and other global “megatrends” make our plants and ecosystems more exposed and vulnerable; a new report proposes.

https://1cecf2ca2e0eddfcbd7d85fa2164c2c7.safeframe.googlesyndication.com/safeframe/1-0-40/html/container.html

The prediction is contained in the “Global Change and New Zealand Biosecurity” report, published today by the Better Border Biosecurity (B3) research collaboration. The report is the culmination of a two-year government funded B3 research project to review how global changes could impact New Zealand’s plant biosecurity system and the various productive and natural ecosystems it protects.

B3 is a national biosecurity collaboration that links world-class scientists with government agencies, industry and iwi to collectively strengthen New Zealand’s defenses and protect our precious plants.

B3 project leader Nicolas Meurisse was one of four report authors. The invasion ecologist says New Zealand is already experiencing the negative impacts of established invasive species and future changes in land use and agricultural practices will exacerbate some of these impacts. Other trends such as climate change and globally increasing pest emergences and movements will also challenge our ability to prevent future invasions.

“Biological invasions are already a big concern for New Zealand with its unique insular ecosystems and being home to one of the highest proportions of threatened indigenous species in the world. Our economy is also very dependent on our primary sector. We knew global change would bring more challenges so we began to study what these were likely to be and how we can prepare for them.”

The project team reviewed the many “global megatrends” that will affect our future and, specifically, New Zealand’s plant border biosecurity systems. They found megatrends and their impacts were interconnected and complex and the resulting future, consequently, extremely difficult to predict. However, megatrends such as changes in trade routes, extreme weather, sea and air currents, human movement, and international conflict are all likely to result in an increased risk of entry to New Zealand by “alien” plant pests.

Meurisse says one of the most predictable—and impactful—megatrends is rising CO2 levels and resulting warmer climates. This became a focus of the report. Climate change will affect our growing environments and the pests and diseases that threaten them, both “sleeper” threats already in New Zealand and new “alien” ones, and significantly affect future biosecurity risk.

The report found:

  • Existing crops, such as kiwifruit, citrus, grapes and avocados, may be grown in new areas as local climates change; new crops may become viable, such as peanuts, soybeans, chickpeas, quinoa, oats, pineapple, banana and rice. Other land use changes will likely favor more forestry and dairy industries, and reduced sheep and beef production.
  • These current and future crops, as well as plants in natural landscapes (which cannot be moved to suit warmer climates), will likely be threatened by new suites of pests, weeds and pathogens that may or may not already be present in New Zealand.
  • Predicting exactly which ‘alien’ pest and pathogen species will emerge and threaten New Zealand as a result of global change will be difficult, so New Zealand’s border biosecurity system must be robust, resilient and responsive to new threats as they appear. A key factor will be the health of our ecosystems and their resilience to extreme events, such as local floods, droughts, and wildfires. These events may facilitate spread of pests and diseases, which in turn affect the resilience of ecosystems to extreme events.

Meurisse says natural environments, such as native forests, may be especially vulnerable to invading biosecurity threats. These could be adversely impacted by the combined effects of biological invasions, climate warming and other human-related pressures.

The report says research is needed to address the biosecurity implications of global megatrends, including climate change and ensure New Zealand’s border system is robust, resilient and responsive to the wide range of future biosecurity challenges, both predictable and unpredictable. Examples include developing new methods to forecast, track and monitor changing border pressures, and better understanding the vulnerabilities of New Zealand plants and ecosystems and potential impacts of invasive pests and pathogens.

The report concludes: “It is impossible to predict the future, particularly in an area as complex as global change where so many factors are interacting. Preparing for future biosecurity challenges needs to be a collective task to ensure we are able to respond as needed to protect New Zealand’s unique plant systems.”

B3 Co Director Māori Alby Marsh says the collaboration has a new Māori Strategy that, among other things, recognizes Te Tiriti and the overarching principles of Partnership, Protection and Participation with Mana Whenua in all B3 research programs.

“It is important for us as researchers to be inclusive with our science by fostering deeper meaningful relationships to better understand mātauranga and develop programs of research that encourages broader representation and participation. The Global Change and New Zealand Biosecurity report highlights coming issues of huge importance for tangata whenua and the plants they grow and nurture. Mātauranga Māori experts are also observing this change and are trying to understand the impacts of climate warming. For example, ‘tohu’ or environmental indicators and the timing of their occurrence may be changing which could have a bearing on the timing of planting or harvest,” he says.

Provided by Better Border Biosecurity (B3)

Posted in Biosecurity, Climate change, Emerging/invasive pests, Plant Pathogens | Leave a Comment »

Older Posts »